ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baet99d06 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ224325.1|HVH224325 Hordeum vulgare cv. Haisa mRNA for cp33Hv protein Length = 1311 Score = 888 bits (448), Expect = 0.0 Identities = 453/455 (99%) Strand = Plus / Plus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 468 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 527 Query: 62 ggaggctgccaaggccgtccagatgttcaacggagccctgctgggagggaggacagtcag 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 528 ggaggctgccaaggccgtccagatgttcaacggagccctgctgggagggaggacagtcag 587 Query: 122 ggtgaatttcccggaagtgccgcgaggaggagaaagggcagtggcatcggcagcggttgc 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 588 ggtgaatttcccggaagtgccgcgaggaggagaaagggcagtggcatcggcagcggttgc 647 Query: 182 aaggactagcttgcgtgttgttgacgatgggacatacaaggtttacgccggcaacttggg 241 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 648 aaggactagcttgcgtgttgttgacgatgggacatacaaggtttacgccggcaacctggg 707 Query: 242 ttggggtgtgcgggctgacgcactcaagacggcatttgaagggcagcctggcttggttgg 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 708 ttggggtgtgcgggctgacgcactcaagacggcatttgaagggcagcctggcttggttgg 767 Query: 302 tgccagggtaatcttcgagcgtgacaccggtcgttcgagggggtttggctttgtctcctt 361 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 768 tgccagggtaatcttcgagcgtgacaccggtcgttcgagggggtttggctttgtctcctt 827 Query: 362 ccacaccatacaagatgcanaggctgccttgcaggccatggacggagtggaactggatgg 421 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 828 ccacaccatacaagatgcaaaggctgccttgcaggccatggacggagtggaactggatgg 887 Query: 422 gaggccactccgacttagtctggcagcacagaacc 456 ||||||||||||||||||||||||||||||||||| Sbjct: 888 gaggccactccgacttagtctggcagcacagaacc 922
>ref|XM_476683.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1299 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Plus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 ||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 488 ctatgacaaggtcaccgaccggagccgcggcttcgccttcgtcaccatggccaccgccga 547 Query: 62 ggaggctgccaaggccgtccagatgttcaacggagccctgctgggagggaggacagtcag 121 ||||||||||| ||| ||||||||||||| || |||||||| ||||||||||| | || Sbjct: 548 ggaggctgccaccgccatccagatgttcaatggggccctgcttggagggaggactgcaag 607 Query: 122 ggtgaatttcccggaagtgccgcgaggaggagaaagggcagtggcatcggcagcgg 177 |||||| | |||||| |||||||| ||||| || ||||| |||| |||||| |||| Sbjct: 608 ggtgaactacccggaggtgccgcggggaggggagagggcggtgggatcggcggcgg 663 Score = 71.9 bits (36), Expect = 2e-09 Identities = 161/203 (79%) Strand = Plus / Plus Query: 228 gccggcaacttgggttggggtgtgcgggctgacgcactcaagacggcatttgaagggcag 287 ||||| ||| |||| ||||||||||| || || || || | | |||| || || |||||| Sbjct: 708 gccgggaacctggggtggggtgtgcgtgccgatgctctgagggcggcgttcgaggggcag 767 Query: 288 cctggcttggttggtgccagggtaatcttcgagcgtgacaccggtcgttcgagggggttt 347 || |||||| ||| ||| ||||| ||||||||||| ||| ||||||| || ||||| || Sbjct: 768 cccggcttgcttgatgctagggtcatcttcgagcgcgactccggtcggtccaggggtttc 827 Query: 348 ggctttgtctccttccacaccatacaagatgcanaggctgccttgcaggccatggacgga 407 || || ||||||||| || | | |||||| ||||||| ||| |||| |||| ||| Sbjct: 828 ggattcgtctccttcaggactgcagaggatgcacaggctgcattggaggcattggatgga 887 Query: 408 gtggaactggatgggaggccact 430 ||||||||||| || |||||||| Sbjct: 888 gtggaactggaaggaaggccact 910
>ref|XM_507351.1| PREDICTED Oryza sativa (japonica cultivar-group), P0455F03.24 mRNA Length = 1327 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Plus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 ||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 486 ctatgacaaggtcaccgaccggagccgcggcttcgccttcgtcaccatggccaccgccga 545 Query: 62 ggaggctgccaaggccgtccagatgttcaacggagccctgctgggagggaggacagtcag 121 ||||||||||| ||| ||||||||||||| || |||||||| ||||||||||| | || Sbjct: 546 ggaggctgccaccgccatccagatgttcaatggggccctgcttggagggaggactgcaag 605 Query: 122 ggtgaatttcccggaagtgccgcgaggaggagaaagggcagtggcatcggcagcgg 177 |||||| | |||||| |||||||| ||||| || ||||| |||| |||||| |||| Sbjct: 606 ggtgaactacccggaggtgccgcggggaggggagagggcggtgggatcggcggcgg 661 Score = 71.9 bits (36), Expect = 2e-09 Identities = 161/203 (79%) Strand = Plus / Plus Query: 228 gccggcaacttgggttggggtgtgcgggctgacgcactcaagacggcatttgaagggcag 287 ||||| ||| |||| ||||||||||| || || || || | | |||| || || |||||| Sbjct: 706 gccgggaacctggggtggggtgtgcgtgccgatgctctgagggcggcgttcgaggggcag 765 Query: 288 cctggcttggttggtgccagggtaatcttcgagcgtgacaccggtcgttcgagggggttt 347 || |||||| ||| ||| ||||| ||||||||||| ||| ||||||| || ||||| || Sbjct: 766 cccggcttgcttgatgctagggtcatcttcgagcgcgactccggtcggtccaggggtttc 825 Query: 348 ggctttgtctccttccacaccatacaagatgcanaggctgccttgcaggccatggacgga 407 || || ||||||||| || | | |||||| ||||||| ||| |||| |||| ||| Sbjct: 826 ggattcgtctccttcaggactgcagaggatgcacaggctgcattggaggcattggatgga 885 Query: 408 gtggaactggatgggaggccact 430 ||||||||||| || |||||||| Sbjct: 886 gtggaactggaaggaaggccact 908
>ref|XM_506168.2| PREDICTED Oryza sativa (japonica cultivar-group), P0455F03.24 mRNA Length = 1390 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Plus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 ||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 503 ctatgacaaggtcaccgaccggagccgcggcttcgccttcgtcaccatggccaccgccga 562 Query: 62 ggaggctgccaaggccgtccagatgttcaacggagccctgctgggagggaggacagtcag 121 ||||||||||| ||| ||||||||||||| || |||||||| ||||||||||| | || Sbjct: 563 ggaggctgccaccgccatccagatgttcaatggggccctgcttggagggaggactgcaag 622 Query: 122 ggtgaatttcccggaagtgccgcgaggaggagaaagggcagtggcatcggcagcgg 177 |||||| | |||||| |||||||| ||||| || ||||| |||| |||||| |||| Sbjct: 623 ggtgaactacccggaggtgccgcggggaggggagagggcggtgggatcggcggcgg 678 Score = 71.9 bits (36), Expect = 2e-09 Identities = 161/203 (79%) Strand = Plus / Plus Query: 228 gccggcaacttgggttggggtgtgcgggctgacgcactcaagacggcatttgaagggcag 287 ||||| ||| |||| ||||||||||| || || || || | | |||| || || |||||| Sbjct: 723 gccgggaacctggggtggggtgtgcgtgccgatgctctgagggcggcgttcgaggggcag 782 Query: 288 cctggcttggttggtgccagggtaatcttcgagcgtgacaccggtcgttcgagggggttt 347 || |||||| ||| ||| ||||| ||||||||||| ||| ||||||| || ||||| || Sbjct: 783 cccggcttgcttgatgctagggtcatcttcgagcgcgactccggtcggtccaggggtttc 842 Query: 348 ggctttgtctccttccacaccatacaagatgcanaggctgccttgcaggccatggacgga 407 || || ||||||||| || | | |||||| ||||||| ||| |||| |||| ||| Sbjct: 843 ggattcgtctccttcaggactgcagaggatgcacaggctgcattggaggcattggatgga 902 Query: 408 gtggaactggatgggaggccact 430 ||||||||||| || |||||||| Sbjct: 903 gtggaactggaaggaaggccact 925
>dbj|AK104773.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-B02, full insert sequence Length = 1327 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Plus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 ||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 486 ctatgacaaggtcaccgaccggagccgcggcttcgccttcgtcaccatggccaccgccga 545 Query: 62 ggaggctgccaaggccgtccagatgttcaacggagccctgctgggagggaggacagtcag 121 ||||||||||| ||| ||||||||||||| || |||||||| ||||||||||| | || Sbjct: 546 ggaggctgccaccgccatccagatgttcaatggggccctgcttggagggaggactgcaag 605 Query: 122 ggtgaatttcccggaagtgccgcgaggaggagaaagggcagtggcatcggcagcgg 177 |||||| | |||||| |||||||| ||||| || ||||| |||| |||||| |||| Sbjct: 606 ggtgaactacccggaggtgccgcggggaggggagagggcggtgggatcggcggcgg 661 Score = 71.9 bits (36), Expect = 2e-09 Identities = 161/203 (79%) Strand = Plus / Plus Query: 228 gccggcaacttgggttggggtgtgcgggctgacgcactcaagacggcatttgaagggcag 287 ||||| ||| |||| ||||||||||| || || || || | | |||| || || |||||| Sbjct: 706 gccgggaacctggggtggggtgtgcgtgccgatgctctgagggcggcgttcgaggggcag 765 Query: 288 cctggcttggttggtgccagggtaatcttcgagcgtgacaccggtcgttcgagggggttt 347 || |||||| ||| ||| ||||| ||||||||||| ||| ||||||| || ||||| || Sbjct: 766 cccggcttgcttgatgctagggtcatcttcgagcgcgactccggtcggtccaggggtttc 825 Query: 348 ggctttgtctccttccacaccatacaagatgcanaggctgccttgcaggccatggacgga 407 || || ||||||||| || | | |||||| ||||||| ||| |||| |||| ||| Sbjct: 826 ggattcgtctccttcaggactgcagaggatgcacaggctgcattggaggcattggatgga 885 Query: 408 gtggaactggatgggaggccact 430 ||||||||||| || |||||||| Sbjct: 886 gtggaactggaaggaaggccact 908
>dbj|AK099188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023110K07, full insert sequence Length = 1299 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Plus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 ||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 488 ctatgacaaggtcaccgaccggagccgcggcttcgccttcgtcaccatggccaccgccga 547 Query: 62 ggaggctgccaaggccgtccagatgttcaacggagccctgctgggagggaggacagtcag 121 ||||||||||| ||| ||||||||||||| || |||||||| ||||||||||| | || Sbjct: 548 ggaggctgccaccgccatccagatgttcaatggggccctgcttggagggaggactgcaag 607 Query: 122 ggtgaatttcccggaagtgccgcgaggaggagaaagggcagtggcatcggcagcgg 177 |||||| | |||||| |||||||| ||||| || ||||| |||| |||||| |||| Sbjct: 608 ggtgaactacccggaggtgccgcggggaggggagagggcggtgggatcggcggcgg 663 Score = 71.9 bits (36), Expect = 2e-09 Identities = 161/203 (79%) Strand = Plus / Plus Query: 228 gccggcaacttgggttggggtgtgcgggctgacgcactcaagacggcatttgaagggcag 287 ||||| ||| |||| ||||||||||| || || || || | | |||| || || |||||| Sbjct: 708 gccgggaacctggggtggggtgtgcgtgccgatgctctgagggcggcgttcgaggggcag 767 Query: 288 cctggcttggttggtgccagggtaatcttcgagcgtgacaccggtcgttcgagggggttt 347 || |||||| ||| ||| ||||| ||||||||||| ||| ||||||| || ||||| || Sbjct: 768 cccggcttgcttgatgctagggtcatcttcgagcgcgactccggtcggtccaggggtttc 827 Query: 348 ggctttgtctccttccacaccatacaagatgcanaggctgccttgcaggccatggacgga 407 || || ||||||||| || | | |||||| ||||||| ||| |||| |||| ||| Sbjct: 828 ggattcgtctccttcaggactgcagaggatgcacaggctgcattggaggcattggatgga 887 Query: 408 gtggaactggatgggaggccact 430 ||||||||||| || |||||||| Sbjct: 888 gtggaactggaaggaaggccact 910
>dbj|AK067376.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106F16, full insert sequence Length = 1389 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Plus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 ||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 502 ctatgacaaggtcaccgaccggagccgcggcttcgccttcgtcaccatggccaccgccga 561 Query: 62 ggaggctgccaaggccgtccagatgttcaacggagccctgctgggagggaggacagtcag 121 ||||||||||| ||| ||||||||||||| || |||||||| ||||||||||| | || Sbjct: 562 ggaggctgccaccgccatccagatgttcaatggggccctgcttggagggaggactgcaag 621 Query: 122 ggtgaatttcccggaagtgccgcgaggaggagaaagggcagtggcatcggcagcgg 177 |||||| | |||||| |||||||| ||||| || ||||| |||| |||||| |||| Sbjct: 622 ggtgaactacccggaggtgccgcggggaggggagagggcggtgggatcggcggcgg 677 Score = 71.9 bits (36), Expect = 2e-09 Identities = 161/203 (79%) Strand = Plus / Plus Query: 228 gccggcaacttgggttggggtgtgcgggctgacgcactcaagacggcatttgaagggcag 287 ||||| ||| |||| ||||||||||| || || || || | | |||| || || |||||| Sbjct: 722 gccgggaacctggggtggggtgtgcgtgccgatgctctgagggcggcgttcgaggggcag 781 Query: 288 cctggcttggttggtgccagggtaatcttcgagcgtgacaccggtcgttcgagggggttt 347 || |||||| ||| ||| ||||| ||||||||||| ||| ||||||| || ||||| || Sbjct: 782 cccggcttgcttgatgctagggtcatcttcgagcgcgactccggtcggtccaggggtttc 841 Query: 348 ggctttgtctccttccacaccatacaagatgcanaggctgccttgcaggccatggacgga 407 || || ||||||||| || | | |||||| ||||||| ||| |||| |||| ||| Sbjct: 842 ggattcgtctccttcaggactgcagaggatgcacaggctgcattggaggcattggatgga 901 Query: 408 gtggaactggatgggaggccact 430 ||||||||||| || |||||||| Sbjct: 902 gtggaactggaaggaaggccact 924
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 123 bits (62), Expect = 5e-25 Identities = 83/90 (92%) Strand = Plus / Minus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 ||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 3156158 ctatgacaaggtcaccgaccggagccgcggcttcgccttcgtcaccatggccaccgccga 3156099 Query: 62 ggaggctgccaaggccgtccagatgttcaa 91 ||||||||||| ||| ||||||||||||| Sbjct: 3156098 ggaggctgccaccgccatccagatgttcaa 3156069 Score = 61.9 bits (31), Expect = 2e-06 Identities = 109/135 (80%) Strand = Plus / Minus Query: 228 gccggcaacttgggttggggtgtgcgggctgacgcactcaagacggcatttgaagggcag 287 ||||| ||| |||| ||||||||||| || || || || | | |||| || || |||||| Sbjct: 3155810 gccgggaacctggggtggggtgtgcgtgccgatgctctgagggcggcgttcgaggggcag 3155751 Query: 288 cctggcttggttggtgccagggtaatcttcgagcgtgacaccggtcgttcgagggggttt 347 || |||||| ||| ||| ||||| ||||||||||| ||| ||||||| || ||||| || Sbjct: 3155750 cccggcttgcttgatgctagggtcatcttcgagcgcgactccggtcggtccaggggtttc 3155691 Query: 348 ggctttgtctccttc 362 || || ||||||||| Sbjct: 3155690 ggattcgtctccttc 3155676 Score = 54.0 bits (27), Expect = 4e-04 Identities = 66/79 (83%) Strand = Plus / Minus Query: 99 ctgctgggagggaggacagtcagggtgaatttcccggaagtgccgcgaggaggagaaagg 158 ||||| ||||||||||| | |||||||| | |||||| |||||||| ||||| || ||| Sbjct: 3155933 ctgcttggagggaggactgcaagggtgaactacccggaggtgccgcggggaggggagagg 3155874 Query: 159 gcagtggcatcggcagcgg 177 || |||| |||||| |||| Sbjct: 3155873 gcggtgggatcggcggcgg 3155855
>dbj|AP005454.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0455F03 Length = 158201 Score = 123 bits (62), Expect = 5e-25 Identities = 83/90 (92%) Strand = Plus / Minus Query: 2 ctatgacaaaatcacagaccggagccgcggcttcgcctttgtcaccatggccaccgccga 61 ||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 71148 ctatgacaaggtcaccgaccggagccgcggcttcgccttcgtcaccatggccaccgccga 71089 Query: 62 ggaggctgccaaggccgtccagatgttcaa 91 ||||||||||| ||| ||||||||||||| Sbjct: 71088 ggaggctgccaccgccatccagatgttcaa 71059 Score = 61.9 bits (31), Expect = 2e-06 Identities = 109/135 (80%) Strand = Plus / Minus Query: 228 gccggcaacttgggttggggtgtgcgggctgacgcactcaagacggcatttgaagggcag 287 ||||| ||| |||| ||||||||||| || || || || | | |||| || || |||||| Sbjct: 70800 gccgggaacctggggtggggtgtgcgtgccgatgctctgagggcggcgttcgaggggcag 70741 Query: 288 cctggcttggttggtgccagggtaatcttcgagcgtgacaccggtcgttcgagggggttt 347 || |||||| ||| ||| ||||| ||||||||||| ||| ||||||| || ||||| || Sbjct: 70740 cccggcttgcttgatgctagggtcatcttcgagcgcgactccggtcggtccaggggtttc 70681 Query: 348 ggctttgtctccttc 362 || || ||||||||| Sbjct: 70680 ggattcgtctccttc 70666 Score = 54.0 bits (27), Expect = 4e-04 Identities = 66/79 (83%) Strand = Plus / Minus Query: 99 ctgctgggagggaggacagtcagggtgaatttcccggaagtgccgcgaggaggagaaagg 158 ||||| ||||||||||| | |||||||| | |||||| |||||||| ||||| || ||| Sbjct: 70923 ctgcttggagggaggactgcaagggtgaactacccggaggtgccgcggggaggggagagg 70864 Query: 159 gcagtggcatcggcagcgg 177 || |||| |||||| |||| Sbjct: 70863 gcggtgggatcggcggcgg 70845
>emb|AJ272011.1|NPL272011 Nicotiana plumbaginifolia mRNA for oligouridylate binding protein (ubp1 gene) Length = 1668 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Plus Query: 336 tcgagggggtttggctttgtctccttcc 363 |||||||||||||| ||||||||||||| Sbjct: 698 tcgagggggtttggatttgtctccttcc 725
>gb|L16679.3| Caenorhabditis elegans cosmid K07D8, complete sequence Length = 14407 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 145 gaggaggagaaagggcagtggca 167 ||||||||||||||||||||||| Sbjct: 12287 gaggaggagaaagggcagtggca 12309
>gb|AC006605.1| Caenorhabditis elegans cosmid C07H6, complete sequence Length = 55169 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 145 gaggaggagaaagggcagtggca 167 ||||||||||||||||||||||| Sbjct: 8193 gaggaggagaaagggcagtggca 8215
>gb|AC164428.4| Mus musculus BAC clone RP24-150D18 from chromosome 1, complete sequence Length = 170692 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 405 ggagtggaactggatgggagg 425 ||||||||||||||||||||| Sbjct: 40240 ggagtggaactggatgggagg 40260
>gb|AC121861.3| Mus musculus BAC clone RP24-108P23 from chromosome 1, complete sequence Length = 185558 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 405 ggagtggaactggatgggagg 425 ||||||||||||||||||||| Sbjct: 67367 ggagtggaactggatgggagg 67347
>ref|XM_779770.1| PREDICTED: Strongylocentrotus purpuratus similar to Nuclear receptor ROR-alpha (Nuclear receptor RZR-alpha) (LOC579666), partial mRNA Length = 3311 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 401 ggacggagtggaactggatgg 421 ||||||||||||||||||||| Sbjct: 241 ggacggagtggaactggatgg 221
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 55 ccgccgaggaggctgccaagg 75 ||||||||||||||||||||| Sbjct: 949921 ccgccgaggaggctgccaagg 949941
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 ttcgcctttgtcaccatggcc 53 ||||||||||||||||||||| Sbjct: 3403490 ttcgcctttgtcaccatggcc 3403470
>emb|AL670708.9| Mouse DNA sequence from clone RP23-125A21 on chromosome 4, complete sequence Length = 207097 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 405 ggagtggaactggatgggagg 425 ||||||||||||||||||||| Sbjct: 127600 ggagtggaactggatgggagg 127580
>ref|XM_511930.1| PREDICTED: Pan troglodytes LOC455180 (LOC455180), mRNA Length = 2712 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 172 tggcttggttggtgccaggg 153
>ref|NM_003110.4| Homo sapiens Sp2 transcription factor (SP2), mRNA Length = 3031 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 510 tggcttggttggtgccaggg 491
>ref|NM_178005.1| Mus musculus leucine rich repeat transmembrane neuronal 2 (Lrrtm2), mRNA Length = 3660 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 354 gtctccttccacaccataca 373 |||||||||||||||||||| Sbjct: 3248 gtctccttccacaccataca 3229
>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete sequence Length = 1438950 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 aggaggctgccaaggccgtccaga 84 ||||||||||||||| |||||||| Sbjct: 554701 aggaggctgccaaggtcgtccaga 554678
>gb|BC033814.2| Homo sapiens Sp2 transcription factor, mRNA (cDNA clone MGC:45308 IMAGE:5208525), complete cds Length = 3031 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 510 tggcttggttggtgccaggg 491
>gb|BC016680.2| Homo sapiens Sp2 transcription factor, mRNA (cDNA clone MGC:21349 IMAGE:4338754), complete cds Length = 2876 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 526 tggcttggttggtgccaggg 507
>ref|XM_571319.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNF01900) partial mRNA Length = 491 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 aggaggctgccaaggccgtccaga 84 ||||||||||||||| |||||||| Sbjct: 92 aggaggctgccaaggtcgtccaga 115
>gb|AC121874.2| Mus musculus BAC clone RP24-124K16 from 18, complete sequence Length = 164190 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 354 gtctccttccacaccataca 373 |||||||||||||||||||| Sbjct: 82448 gtctccttccacaccataca 82429
>gb|AC113025.9| Mus musculus chromosome 6, clone RP23-196D12, complete sequence Length = 223925 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 411 gaactggatgggaggccact 430 |||||||||||||||||||| Sbjct: 176819 gaactggatgggaggccact 176800
>gb|AC018521.8| Homo sapiens chromosome 17, clone RP11-6N17, complete sequence Length = 143494 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 80651 tggcttggttggtgccaggg 80670
>gb|U38483.1|DCU38483 Dianthus caryophyllus (CEBP-1) mRNA, complete cds Length = 1217 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 30 ggcttcgcctttgtcaccatggcc 53 ||||||| |||||||||||||||| Sbjct: 836 ggcttcggctttgtcaccatggcc 859
>dbj|AK046818.1| Mus musculus 10 days neonate medulla oblongata cDNA, RIKEN full-length enriched library, clone:B830014K09 product:KIAA0416 PROTEIN homolog [Homo sapiens], full insert sequence Length = 3463 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 354 gtctccttccacaccataca 373 |||||||||||||||||||| Sbjct: 3249 gtctccttccacaccataca 3230
>dbj|AK049920.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630011A14 product:hypothetical RNI-like structure containing protein, full insert sequence Length = 3660 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 354 gtctccttccacaccataca 373 |||||||||||||||||||| Sbjct: 3248 gtctccttccacaccataca 3229
>emb|BX817526.1|CNS0AEM3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL28ZH10 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 451 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 146 aggaggagaaagggcagtgg 165 |||||||||||||||||||| Sbjct: 249 aggaggagaaagggcagtgg 268
>ref|NM_001015654.1| Bos taurus Sp2 transcription factor (SP2), mRNA Length = 2592 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 580 tggcttggttggtgccaggg 561
>gb|AC136967.1| Papio anubis clone RP41-30N22, complete sequence Length = 194730 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 143 gcgaggaggagaaagggcag 162 |||||||||||||||||||| Sbjct: 177329 gcgaggaggagaaagggcag 177348
>gb|AY893027.1| Synthetic construct Homo sapiens clone FLH119731.01L Sp2 transcription factor (SP2) mRNA, partial cds Length = 1821 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 475 tggcttggttggtgccaggg 456
>gb|AY890560.1| Synthetic construct Homo sapiens clone FLH119735.01X Sp2 transcription factor (SP2) mRNA, complete cds Length = 1821 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 475 tggcttggttggtgccaggg 456
>dbj|D28588.1|HUMKG1D Homo sapiens KIAA0048 mRNA, partial cds Length = 3288 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 809 tggcttggttggtgccaggg 790
>gb|BC005914.1| Homo sapiens Sp2 transcription factor, mRNA (cDNA clone IMAGE:4095335), complete cds Length = 1848 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 536 tggcttggttggtgccaggg 517
>gb|BT020830.1| Bos taurus Sp2 transcription factor (SP2), mRNA, complete cds Length = 2592 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 580 tggcttggttggtgccaggg 561
>dbj|AK122278.1| Mus musculus mRNA for mKIAA0416 protein Length = 5650 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 354 gtctccttccacaccataca 373 |||||||||||||||||||| Sbjct: 3339 gtctccttccacaccataca 3320
>gb|M97190.1|HUMSP2A Human Sp2 protein mRNA, complete cds Length = 2063 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tggcttggttggtgccaggg 309 |||||||||||||||||||| Sbjct: 508 tggcttggttggtgccaggg 489 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,330,519 Number of Sequences: 3902068 Number of extensions: 3330519 Number of successful extensions: 65432 Number of sequences better than 10.0: 41 Number of HSP's better than 10.0 without gapping: 41 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 65258 Number of HSP's gapped (non-prelim): 166 length of query: 462 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 440 effective length of database: 17,147,199,772 effective search space: 7544767899680 effective search space used: 7544767899680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
