ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl11a01 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ966349.1| Hordeum vulgare subsp. vulgare mRNA for lipoxygenase-like protein (lox gene) Length = 3123 Score = 270 bits (136), Expect = 1e-69 Identities = 151/156 (96%) Strand = Plus / Plus Query: 5 agcgagaaacatatccccctgcccggccagccgacctgacccatttcatccccggcgagc 64 ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 50 agcgagaaacatatccccctgcccggccagccgctctgacccatttcgtccccggcgagc 109 Query: 65 gatcttaaccttgctaatctgcgccgacgagggaggggagcttgtttctacggtcatgcc 124 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 110 gatcttaaccttgctaatctgcgccgacgagggaggggagcttctttctacggtcatgcc 169 Query: 125 ggcgatggagctgctggggagatccttcttgcaggc 160 | |||||||||||||||||||||||||||||||||| Sbjct: 170 gccgatggagctgctggggagatccttcttgcaggc 205
>gb|AC073343.6| Homo sapiens BAC clone RP11-611L7 from 7, complete sequence Length = 173967 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacc 40 |||||||||||||||||||||| Sbjct: 56364 ccccctgcccggccagccgacc 56343
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 85 gcgccgacgagggaggggagcttgtt 110 ||||||| |||||||||||||||||| Sbjct: 133376 gcgccgatgagggaggggagcttgtt 133401
>gb|AC163741.3| Pan troglodytes BAC clone CH251-406E22 from chromosome unknown, complete sequence Length = 169655 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 98197 ccccctgcccggccagccgccctg 98220
>ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfamily A (CYP2A) on chromosome 19 Length = 413528 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 382826 ccccctgcccggccagccgccctg 382849 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 305704 ccccctgcccggccagccg 305722 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 168597 ccccctgcccggccagccg 168579
>gb|AC186184.1| Pan troglodytes chromosome UNKNOWN clone CH251-131M1, complete sequence Length = 135932 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 12837 ccccctgcccggccagccgccctg 12814 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 12886 ccccctgcccggccagccg 12868
>gb|AC183617.3| Pan troglodytes BAC clone CH251-104G17 from chromosome 4, complete sequence Length = 172744 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 105745 ccccctgcccggccagccgccctg 105722 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 105342 ccccctgcccggccagccg 105324
>gb|AC183799.2| Pan troglodytes BAC clone CH251-329J7 from chromosome 7, complete sequence Length = 174044 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 153122 ccccctgcccggccagccgccctg 153145
>ref|XM_653867.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN1355.2), mRNA Length = 1119 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 44 cccatttcatccccggcgag 63 |||||||||||||||||||| Sbjct: 356 cccatttcatccccggcgag 375
>gb|AC183830.2| Pan troglodytes BAC clone CH251-267I9 from chromosome 7, complete sequence Length = 157720 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 108648 ccccctgcccggccagccgccctg 108625
>gb|AC146199.2| Pan troglodytes BAC clone RP43-25F11 from 7, complete sequence Length = 186750 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 54750 ccccctgcccggccagccgccctg 54727
>gb|AC147575.1| Homo sapiens chromosome 5 clone RP11-998B18, complete sequence Length = 190680 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 46172 ccccctgcccggccagccgccctg 46195
>gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, complete sequence Length = 179509 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 148806 ccccctgcccggccagccgccctg 148783 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 149080 ccccctgcccggccagccg 149062
>gb|AC146483.2| Pan troglodytes BAC clone RP43-30K12 from 7, complete sequence Length = 208066 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 166984 ccccctgcccggccagccgtcctg 167007
>gb|AC142525.2| Homo sapiens chromosome 5 clone RP11-1275J23, complete sequence Length = 183459 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 116475 ccccctgcccggccagccgccctg 116498
>gb|AC146166.2| Pan troglodytes BAC clone RP43-1B23 from 7, complete sequence Length = 165177 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 14323 ccccctgcccggccagccgccctg 14300
>gb|AC144512.1| Pan troglodytes BAC clone RP43-51G12 from 7, complete sequence Length = 161807 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 83005 ccccctgcccggccagccgccctg 82982 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 82506 ccccctgcccggccagccgccctg 82483
>gb|AC103849.3| Homo sapiens chromosome 8, clone RP11-75H14, complete sequence Length = 147107 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 45070 ccccctgcccggccagccgccctg 45047
>emb|AL929472.21| Human DNA sequence from clone RP11-109P14 on chromosome 1 Contains a pseudogene similar to part of actinin alpha4 (ACTN4), a novel pseudogene, two genes for novel proteins (FLJ31434, FLJ45459), the gene for ischemia/reperfusion inducible protein (FLJ23476), the MTF1 gene for metal-regulatory transcription factor 1, a ribosomal protein S2 (RPS2) pseudogene, the 3' end of the INPP5B gene for 75kDa nositol polyphosphate-5-phosphatase, two novel genes and four CpG islands, complete sequence Length = 143060 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 125515 ccccctgcccggccagccgccctg 125538 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 3077 ccccctgcccggccagccg 3059 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 2671 ccccctgcccggccagccg 2653
>emb|Z75889.1|HS267P19 Human DNA sequence from clone RP1-267P19 on chromosome 13 Contains part of the gene for androgen-induced prostate proliferative shutoff associated protein (AS3) (CG008, FLJ23236, KIAA0979) and two CpG islands, complete sequence Length = 113704 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 81398 ccccctgcccggccagccgccctg 81421
>emb|AL592294.15| Human DNA sequence from clone RP3-475G16 on chromosome 1 Contains the 5' end of one variant of the ZSWIM5 gene for zinc finger SWIM domain containing 5 and four CpG islands, complete sequence Length = 177710 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 151540 ccccctgcccggccagccgccctg 151563
>emb|AL590710.14| Human DNA sequence from clone RP11-153P4 on chromosome 9 Contains the 3' end of the VAV2 gene for vav 2 oncogene, the 5' end of the SARDH gene for sarcosine dehydrogenase (SAR, SDH, SARD, DMGDHL1) and a CpG island, complete sequence Length = 118671 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 68233 ccccctgcccggccagccgccctg 68256
>emb|AL499604.9| Human DNA sequence from clone RP11-23B15 on chromosome 9 Contains FOXE1 gene for forkhead box E1 (thyroid transcription factor 2), HEMGN gene for hemogen, 2 novel genes and 5 CpG islands, complete sequence Length = 160796 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 15266 ccccctgcccggccagccgccctg 15289
>emb|AL365505.15| Human DNA sequence from clone RP11-382A12 on chromosome 20 Contains the 5' end of the SAMHD1 gene for SAM domain and HD domain 1, the 3' end of the RBL1 gene for retinoblastoma-like protein 1 (p107) and three CpG islands, complete sequence Length = 101500 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 66452 ccccctgcccggccagccgccctg 66429
>emb|AL356957.27| Human DNA sequence from clone RP11-403I13 on chromosome 1 Contains the 5' end of a novel pseudogene, a profilin 1 (PFN1) pseudogene, six novel genes and a novel pseudogene, complete sequence Length = 204702 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 24333 ccccctgcccggccagccgccctg 24356 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 23756 ccccctgcccggccagccg 23774
>emb|AL354806.22| Human DNA sequence from clone RP11-521J24 on chromosome 13 Contains a novel gene, complete sequence Length = 198959 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 120188 ccccctgcccggccagccgccctg 120165
>gb|AC183592.2| Pan troglodytes BAC clone CH251-733I16 from chromosome 10, complete sequence Length = 167069 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 29167 ccccctgcccggccagccgccctg 29190 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 29472 ccccctgcccggccagccg 29490
>emb|AL161644.6| Human DNA sequence from clone RP5-997D24 on chromosome 1 Contains the 3' end of the MRPL37 gene for mitochondrial ribosomal protein L37, two novel genes, the 3' end of the SSBP3 gene for single stranded DNA binding protein 3, a novel protein (MSTP128) and a CpG island, complete sequence Length = 83463 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 19248 ccccctgcccggccagccgccctg 19271 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 19072 ccccctgcccggccagccg 19090
>emb|AL024507.7|HS191J18 Human DNA sequence from clone RP1-191J18 on chromosome 6q16.1-22.33 Contains the SEC63 gene for SEC63-like (S. cerevisiae), a 60S ribosomal protein 23A (RPL23A) pseudogene, a ribosomal protein L14 (RPL14) pseudogene, a pseudogene similar to part of methylene tetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase (MTHFD2) (NMDMC) and three CpG islands, complete sequence Length = 152408 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 45857 ccccctgcccggccagccgccctg 45834 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 64883 ccccctgcccggccagccg 64865 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 64610 ccccctgcccggccagccg 64592
>emb|AL034374.2|HS483K16 Human DNA sequence from clone RP3-483K16 on chromosome 6p12.1-21.1 Contains the gene for homolog of yeast long chain polyunsaturated fatty acid elongation enzyme 2 (HELO1), a 40S Ribosomal protein (RPS16) pseudogene, a 60S Ribosomal protein (RPL31) pseudogene and CpG islands, complete sequence Length = 101270 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 40583 ccccctgcccggccagccgccctg 40560
>emb|AL021918.1|HS34I8 Human DNA sequence from clone XXbac-34I8 on chromosome 6p21.3-22.1 Contains the 5' end of the ZNF184 gene for Kruppel-like zinc finger protein 184, a heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene, a CD83 antigen pseudogene, ESTs, STSs, GSSs and three CpG islands, complete sequence Length = 159506 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tccccctgcccggccagccg 37 |||||||||||||||||||| Sbjct: 33818 tccccctgcccggccagccg 33799 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 33638 ccccctgcccggccagccg 33620
>gb|AC107952.5| Homo sapiens chromosome 8, clone RP11-140I16, complete sequence Length = 142102 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 135827 ccccctgcccggccagccgccctg 135804
>gb|AC183687.3| Pan troglodytes BAC clone CH251-25N14 from chromosome 1, complete sequence Length = 192054 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 168767 ccccctgcccggccagccgccctg 168790
>gb|AC182637.3| Pan troglodytes BAC clone CH251-431A15 from chromosome 7, complete sequence Length = 186750 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 135330 ccccctgcccggccagccgccctg 135307 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 135024 ccccctgcccggccagccg 135006
>gb|AC148926.4| Pan troglodytes BAC clone RP43-136P16 from chromosome 7, complete sequence Length = 178320 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 63880 ccccctgcccggccagccgccctg 63857 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 63279 ccccctgcccggccagccgccctg 63256
>gb|AC163739.2| Pan troglodytes BAC clone CH251-503F22 from chromosome unknown, complete sequence Length = 220347 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 108079 ccccctgcccggccagccgccctg 108056
>gb|AC024568.6| Homo sapiens chromosome 5 clone CTD-2179L22, complete sequence Length = 128501 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 24646 ccccctgcccggccagccgccctg 24623 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 24374 ccccctgcccggccagccg 24356
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 cgacctgacccatttcatcc 55 |||||||||||||||||||| Sbjct: 1905117 cgacctgacccatttcatcc 1905136
>gb|AC097489.2| Homo sapiens BAC clone RP11-226A18 from 4, complete sequence Length = 152039 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 77769 ccccctgcccggccagccgccctg 77792 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 77542 ccccctgcccggccagccg 77560 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 77264 ccccctgcccggccagccg 77282 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 77138 ccccctgcccggccagccg 77156
>gb|AC027088.8| Homo sapiens chromosome 15, clone RP11-809H16, complete sequence Length = 187712 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 150398 ccccctgcccggccagccgccctg 150421
>gb|AC157480.3| Pan troglodytes BAC clone CH251-394P5 from chromosome unknown, complete sequence Length = 179883 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 112132 ccccctgcccggccagccgccctg 112155
>gb|AC010355.7| Homo sapiens chromosome 5 clone CTD-2027K22, complete sequence Length = 198396 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 66980 ccccctgcccggccagccgccctg 67003
>gb|AC008493.5| Homo sapiens chromosome 5 clone CTC-427G18, complete sequence Length = 107137 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 61806 ccccctgcccggccagccgccctg 61829 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 62079 ccccctgcccggccagccg 62097
>gb|AC026440.4|AC026440 Homo sapiens chromosome 5 clone CTD-2269F5, complete sequence Length = 103115 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 79620 ccccctgcccggccagccgccctg 79643
>gb|AC021317.19| Homo sapiens chromosome 17, clone RP11-678G7, complete sequence Length = 180876 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tccccctgcccggccagccg 37 |||||||||||||||||||| Sbjct: 46861 tccccctgcccggccagccg 46842
>gb|AC093899.3| Homo sapiens BAC clone RP11-724O16 from 2, complete sequence Length = 172816 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||| |||||||||||||||||| Sbjct: 132643 ccccccgcccggccagccgacctg 132620
>gb|AC008554.8| Homo sapiens chromosome 19 clone CTC-513N18, complete sequence Length = 166873 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 139428 ccccctgcccggccagccgccctg 139405 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 13530 ccccctgcccggccagccg 13548 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 13352 ccccctgcccggccagccg 13370
>gb|AC147282.3| Pan troglodytes BAC clone RP43-86L11 from chromosome 7, complete sequence Length = 223086 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 123496 ccccctgcccggccagccgccctg 123473
>gb|AC145873.3| Pan troglodytes BAC clone RP43-20K16 from chromosome 7, complete sequence Length = 149916 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 113227 ccccctgcccggccagccgccctg 113250
>gb|AC112510.9| Homo sapiens 3 BAC RP11-432A8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 192749 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 5466 ccccctgcccggccagccgccctg 5489 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 4628 ccccctgcccggccagccg 4646
>gb|AC087393.7| Homo sapiens chromosome 17, clone RP11-746M1, complete sequence Length = 235968 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tccccctgcccggccagccg 37 |||||||||||||||||||| Sbjct: 225593 tccccctgcccggccagccg 225574 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 226047 ccccctgcccggccagccg 226029 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 225868 ccccctgcccggccagccg 225850
>gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195B23, complete sequence Length = 129402 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 9298 ccccctgcccggccagccgccctg 9321
>gb|AC020550.4| Homo sapiens BAC clone RP11-198M19 from 2, complete sequence Length = 172813 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 47551 ccccctgcccggccagccgccctg 47528
>gb|AC159904.2| Pan troglodytes BAC clone CH251-488L1 from chromosome unknown, complete sequence Length = 177340 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 159221 ccccctgcccggccagccgccctg 159244
>gb|AC145857.3| Pan troglodytes BAC clone RP43-6D4 from chromosome 7, complete sequence Length = 208516 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 141857 ccccctgcccggccagccgccctg 141834 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 141083 ccccctgcccggccagccgccctg 141060
>gb|AC097468.3| Homo sapiens BAC clone RP11-33O4 from 2, complete sequence Length = 169741 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 11498 ccccctgcccggccagccgccctg 11521 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 11277 ccccctgcccggccagccg 11295
>gb|AC115992.13| Homo sapiens chromosome 17, clone CTD-2022O14, complete sequence Length = 139475 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tccccctgcccggccagccg 37 |||||||||||||||||||| Sbjct: 25424 tccccctgcccggccagccg 25443
>gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence Length = 172761 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 101174 ccccctgcccggccagccgccctg 101197
>gb|AC010636.6|AC010636 Homo sapiens chromosome 19 clone CTD-2332E11, complete sequence Length = 179393 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 133145 ccccctgcccggccagccgccctg 133168
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region Length = 1750601 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 268292 ccccctgcccggccagccgccctg 268315 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 267693 ccccctgcccggccagccgccctg 267716
>dbj|AP000842.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-680F20riken, complete sequence Length = 179848 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 26015 ccccctgcccggccagccgccctg 26038 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 26323 ccccctgcccggccagccg 26341
>gb|AC006344.2|AC006344 Homo sapiens PAC clone RP4-726N20 from 7q32-q34, complete sequence Length = 127447 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 80100 ccccctgcccggccagccgccctg 80077
>emb|CT009602.4| PTB-121B21, complete sequence Length = 236109 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 92208 ccccctgcccggccagccgccctg 92185
>emb|AL121790.4|CNS01DSI Human chromosome 14 DNA sequence BAC R-356O9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 203650 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 84084 ccccctgcccggccagccgccctg 84061
>gb|AC005828.1|AC005828 Homo sapiens chromosome 17, clone hRPK.269_G_24, complete sequence Length = 163685 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 159901 ccccctgcccggccagccgccctg 159924 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 159627 ccccctgcccggccagccg 159645
>gb|AC159020.2| Pan troglodytes BAC clone CH251-530A5 from chromosome unknown, complete sequence Length = 219428 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 215284 ccccctgcccggccagccgccctg 215261
>gb|DQ314884.1| Homo sapiens NADPH oxidase, EF-hand calcium binding domain 5 (NOX5) gene, complete cds Length = 128159 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 34745 ccccctgcccggccagccgccctg 34722
>emb|AL353724.11| Human DNA sequence from clone RP11-448I13 on chromosome 13, complete sequence Length = 120652 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 100539 ccccctgcccggccagccgccctg 100562
>gb|AC106824.2| Homo sapiens chromosome 5 clone RP11-81H9, complete sequence Length = 127326 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccgacctg 42 ||||||||||||||||||| |||| Sbjct: 25493 ccccctgcccggccagccgccctg 25470 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 26025 ccccctgcccggccagccg 26007 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 25138 ccccctgcccggccagccg 25120
>gb|AY795482.1| Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 3 (DNAJC3) gene, complete cds Length = 117695 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 15871 ccccctgcccggccagccg 15853
>gb|AF165926.2| Homo sapiens chromosome 5p13 BAC clone djn085o06 containing NUP155 gene, complete sequence Length = 165617 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 23806 ccccctgcccggccagccg 23824
>gb|L29074.1|HUMFMR1S Homo sapiens fragile X mental retardation syndrome protein (FMR1) gene, alternative splice products, complete cds; and pseudogene, complete sequence Length = 185775 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 94122 ccccctgcccggccagccg 94104 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 94071 ccccctgcccggccagccg 94053
>gb|AC146398.4| Pan troglodytes BAC clone RP43-54K1 from 7, complete sequence Length = 185645 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 101097 ccccctgcccggccagccg 101079
>gb|AC108879.3| Homo sapiens chromosome X clone RP11-265P11 map p11.4, complete sequence Length = 174766 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 104540 ccccctgcccggccagccg 104558 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 104364 ccccctgcccggccagccg 104382
>gb|AC145687.4| Pan troglodytes BAC clone CH251-281C1 from X, complete sequence Length = 138000 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 49919 ccccctgcccggccagccg 49937
>gb|AC142169.2| Homo sapiens fosmid clone XXFOS-81770D1 from 7, complete sequence Length = 37728 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 2507 ccccctgcccggccagccg 2525
>gb|AC145992.2| Pan troglodytes BAC clone RP43-172K3 from 7, complete sequence Length = 208817 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 168126 ccccctgcccggccagccg 168144
>gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chromosome unknown, complete sequence Length = 199482 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 157716 ccccctgcccggccagccg 157698 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 57955 ccccctgcccggccagccg 57937
>gb|AC009712.22| Homo sapiens chromosome 15, clone RP11-361M10, complete sequence Length = 213746 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 192616 ccccctgcccggccagccg 192598
>gb|AC149044.1| Pan troglodytes chromosome X clone PTB-089E19 map human ortholog q27.1, complete sequence Length = 193569 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 56041 ccccctgcccggccagccg 56059 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 55816 ccccctgcccggccagccg 55834
>gb|AC133330.3| Homo sapiens chromosome 8 clone RP11-134N2, complete sequence Length = 164916 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 10310 ccccctgcccggccagccg 10328
>gb|AY663414.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA03715 MHC class II antigen (HLA-DQB1) gene and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0103 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 118048 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 103281 ccccctgcccggccagccg 103299 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 102974 ccccctgcccggccagccg 102992
>gb|AY663411.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14663 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 99966 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 74868 ccccctgcccggccagccg 74886 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 74510 ccccctgcccggccagccg 74528 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 74231 ccccctgcccggccagccg 74249 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 73778 ccccctgcccggccagccg 73796
>gb|AY663409.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA04535 MHC class II antigen (HLA-DQB1) gene and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0505 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 77506 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 68584 ccccctgcccggccagccg 68602 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 68226 ccccctgcccggccagccg 68244 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 67820 ccccctgcccggccagccg 67838
>gb|AY663407.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10923 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*020101 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*050101 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*030101 allele, complete cds Length = 106318 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 24686 ccccctgcccggccagccg 24704
>gb|AY663406.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10923 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*150101 allele, complete cds Length = 103395 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 85431 ccccctgcccggccagccg 85449 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 85073 ccccctgcccggccagccg 85091 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 84794 ccccctgcccggccagccg 84812
>gb|AY663399.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA01018 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*020101 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*050101 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*030101 allele, complete cds Length = 105464 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 18001 ccccctgcccggccagccg 18019
>gb|AY663395.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14660 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 104996 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 74395 ccccctgcccggccagccg 74413 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 74037 ccccctgcccggccagccg 74055 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 73758 ccccctgcccggccagccg 73776 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 73630 ccccctgcccggccagccg 73648
>gb|AC069503.25| Homo sapiens 12 BAC RP11-87C12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 186580 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 63390 ccccctgcccggccagccg 63372
>gb|AC002065.2| Homo sapiens BAC clone CTB-21N8 from 7, complete sequence Length = 117954 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 12752 ccccctgcccggccagccg 12734
>gb|AC103703.5| Homo sapiens chromosome 17, clone RP11-764D10, complete sequence Length = 144240 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 64986 ccccctgcccggccagccg 64968
>gb|AC152064.3| Pan troglodytes BAC clone RP43-134I6 from chromosome 7, complete sequence Length = 179272 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 71080 ccccctgcccggccagccg 71098
>gb|AY500996.1| Homo sapiens angiogenic factor VG5Q gene, complete cds Length = 40275 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 15835 ccccctgcccggccagccg 15817
>gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, complete sequence Length = 148689 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 71199 ccccctgcccggccagccg 71217
>gb|AC073324.6| Homo sapiens BAC clone RP11-339F13 from 7, complete sequence Length = 125253 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 32192 ccccctgcccggccagccg 32174 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 32014 ccccctgcccggccagccg 31996
>gb|AC005192.1| Homo sapiens BAC clone CTB-163K11 from 7, complete sequence Length = 128600 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 90604 ccccctgcccggccagccg 90622
>gb|AC004111.1| Homo sapiens BAC clone CTB-103H13 from 7, complete sequence Length = 106172 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 21788 ccccctgcccggccagccg 21806
>gb|AY526322.1| Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase) (DDC) gene, complete cds Length = 106328 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 102868 ccccctgcccggccagccg 102850 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 102389 ccccctgcccggccagccg 102371
>gb|AC004008.2| Homo sapiens PAC clone RP5-899B21 from 7, complete sequence Length = 90389 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 87216 ccccctgcccggccagccg 87234
>gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete sequence Length = 196954 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 151342 ccccctgcccggccagccg 151360
>gb|AC018705.10| Homo sapiens BAC clone RP11-95E2 from 7, complete sequence Length = 174970 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 52935 ccccctgcccggccagccg 52953 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 52456 ccccctgcccggccagccg 52474
>gb|AC004079.1| Homo sapiens PAC clone RP1-167F23 from 7, complete sequence Length = 102717 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 27930 ccccctgcccggccagccg 27948 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 27754 ccccctgcccggccagccg 27772
>gb|AC146211.3| Pan troglodytes BAC clone RP43-33E10 from 7, complete sequence Length = 164849 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 85449 ccccctgcccggccagccg 85431 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 85001 ccccctgcccggccagccg 84983
>gb|AY203949.1| Homo sapiens LP3428 mRNA, complete cds Length = 1269 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 312 ccccctgcccggccagccg 330
>gb|AC146176.2| Pan troglodytes BAC clone RP43-24N3 from 7, complete sequence Length = 138742 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 94410 ccccctgcccggccagccg 94428
>emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chromosome X, complete sequence Length = 154563 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 125365 ccccctgcccggccagccg 125383
>gb|AC090821.13| Homo sapiens chromosome 8, clone CTD-2309H9, complete sequence Length = 166843 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 33586 ccccctgcccggccagccg 33568
>gb|AC109329.8| Homo sapiens chromosome 8, clone CTD-3107M8, complete sequence Length = 215644 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 11894 ccccctgcccggccagccg 11876 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 11552 ccccctgcccggccagccg 11534
>gb|AC090001.19| Homo sapiens 12 BAC RP11-536G4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 207366 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 153237 ccccctgcccggccagccg 153219
>gb|AC126174.9| Homo sapiens 12 BAC RP11-504F21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 88686 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 54411 ccccctgcccggccagccg 54429 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 14327 ccccctgcccggccagccg 14309
>gb|AC090107.16| Homo sapiens 12 BAC RP11-643D8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 83755 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 59848 ccccctgcccggccagccg 59866
>gb|AC091170.15| Homo sapiens chromosome 18, clone RP11-879D5, complete sequence Length = 198586 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 42354 ccccctgcccggccagccg 42372 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 42029 ccccctgcccggccagccg 42047
>gb|AC091173.10| Homo sapiens chromosome 8, clone RP11-280G9, complete sequence Length = 142265 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 31538 ccccctgcccggccagccg 31556
>gb|AC114801.4| Homo sapiens BAC clone RP11-777B9 from 4, complete sequence Length = 69745 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 42484 ccccctgcccggccagccg 42466
>gb|AC004912.2| Homo sapiens PAC clone RP5-871B15 from 7, complete sequence Length = 157321 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 157250 ccccctgcccggccagccg 157232
>gb|AC004887.2| Homo sapiens PAC clone RP4-789I5 from 7, complete sequence Length = 176929 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 115456 ccccctgcccggccagccg 115438
>gb|AC006451.5| Homo sapiens PAC clone RP4-562A11 from 7, complete sequence Length = 145966 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 29737 ccccctgcccggccagccg 29719 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 5471 ccccctgcccggccagccg 5489
>gb|AC104073.3| Homo sapiens BAC clone RP11-328P23 from 7, complete sequence Length = 178670 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 121710 ccccctgcccggccagccg 121728 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 121309 ccccctgcccggccagccg 121327
>gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, complete sequence Length = 140861 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 58166 ccccctgcccggccagccg 58148 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 33684 ccccctgcccggccagccg 33702 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 33636 ccccctgcccggccagccg 33654
>gb|AC093087.3| Homo sapiens BAC clone RP11-785H2 from 7, complete sequence Length = 123039 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 75524 ccccctgcccggccagccg 75542
>gb|AC004885.2| Homo sapiens PAC clone RP4-781A18 from 7, complete sequence Length = 190842 Score = 38.2 bits (19), Expect = 7.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 20 cccctgcccggccagccgacctg 42 |||||||||||||||||| |||| Sbjct: 17505 cccctgcccggccagccgccctg 17527
>gb|AC006008.2| Homo sapiens PAC clone RP5-820A21 from 7, complete sequence Length = 57554 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 51033 ccccctgcccggccagccg 51015 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 50982 ccccctgcccggccagccg 50964
>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103 genomic sequence Length = 341361 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 134647 ccccctgcccggccagccg 134665 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 134520 ccccctgcccggccagccg 134538 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 134391 ccccctgcccggccagccg 134409
>gb|AC144511.1| Pan troglodytes BAC clone RP43-45C15 from 7, complete sequence Length = 153510 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 92694 ccccctgcccggccagccg 92712
>gb|AY388614.1| Homo sapiens polymerase (DNA directed), eta (POLH) gene, complete cds Length = 40997 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 5652 ccccctgcccggccagccg 5634
>gb|DQ157758.1| Homo sapiens thioredoxin reductase 1 (TXNRD1) gene, complete cds Length = 66886 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 38439 ccccctgcccggccagccg 38421
>gb|AC114934.2| Homo sapiens chromosome 5 clone CTD-2029K19, complete sequence Length = 114356 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 37117 ccccctgcccggccagccg 37099 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 36939 ccccctgcccggccagccg 36921 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 36888 ccccctgcccggccagccg 36870 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 36710 ccccctgcccggccagccg 36692 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 36532 ccccctgcccggccagccg 36514
>gb|AC093304.4| Homo sapiens chromosome 5 clone RP11-69K7, complete sequence Length = 161421 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 39099 ccccctgcccggccagccg 39081 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 39047 ccccctgcccggccagccg 39029 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 38689 ccccctgcccggccagccg 38671
>gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, complete sequence Length = 198564 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 57582 ccccctgcccggccagccg 57564
>gb|DQ070893.1| Homo sapiens AGR2 (AGR2) gene, complete cds, alternatively spliced Length = 62498 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 54626 ccccctgcccggccagccg 54644 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 54353 ccccctgcccggccagccg 54371
>emb|AL731683.12| Human DNA sequence from clone XXbac-254C11 on chromosome 6, complete sequence Length = 83878 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 13823 ccccctgcccggccagccg 13805
>emb|CR854849.7| Human DNA sequence from clone RP13-79M23 on chromosome 1, complete sequence Length = 153012 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 97702 ccccctgcccggccagccg 97684
>gb|AC018988.12| Homo sapiens chromosome 15, clone RP11-233C13, complete sequence Length = 116727 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 107981 ccccctgcccggccagccg 107999
>emb|Z97985.16|HS341D10 Human DNA sequence from clone RP3-341D10 on chromosome X Contains a chondroitin beta 1,4 N-acetylgalactosaminyltransferase (ChGn) pseudogene, a novel gene similar to ADP-ribosylation factor-like 2 (ARL2), variant 1, a novel gene, the 3' end of a novel gene (FLJ12687) and a CpG island, complete sequence Length = 82517 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 31949 ccccctgcccggccagccg 31931
>emb|AL929470.20| Human DNA sequence from clone RP11-72M14 on chromosome 1 Contains the 5' end of the WNT2B gene for wingless-type MMTV integration site family, member 2B, the 5' end of the CAPZA1 gene for capping protein (actin filament) muscle Z-line, alpha 1 and a mitochondrial ribosomal protein L53 (MRPL53) pseudogene, complete sequence Length = 34919 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 26038 ccccctgcccggccagccg 26056
>emb|AL732431.19| Human DNA sequence from clone XXyac-36GH4 on chromosome 6 Contains the gene for acid sphingomyelinase-like phosphodiesterase 3a (ASML3A), an H+ transporting mitochondrial F0 complex ATP synthase subunit g (ATP5L) pseudogene and two CpG islands, complete sequence Length = 164746 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 62640 ccccctgcccggccagccg 62622
>emb|BX255925.17| Human DNA sequence from clone RP13-122B23 on chromosome 9, complete sequence Length = 100719 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 83915 ccccctgcccggccagccg 83933
>emb|Z75746.1|HSU221F2 Human DNA sequence from clone LL0XNC01-221F2 on chromosome X Contains the NXF3 gene for nuclear RNA export factor 3 and a novel pseudogene, complete sequence Length = 37764 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7769 ccccctgcccggccagccg 7787
>emb|Z95889.1|HS211A9 Human DNA sequence from clone CTA-211A9 on chromosome 22q12.1, complete sequence Length = 117939 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 66365 ccccctgcccggccagccg 66347 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 66037 ccccctgcccggccagccg 66019 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 65810 ccccctgcccggccagccg 65792
>emb|Z84489.1|HS93N13 Human DNA sequence from clone RP1-93N13 on chromosome 6p21 Contains the HLA-DRB1*03011 and HLA-DQA1*05011 genes for major histocompatibility complex class II DR beta 1 and DQ alpha 1, a CpG island, ESTs, STSs and GSSs, complete sequence Length = 86896 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 4483 ccccctgcccggccagccg 4501
>emb|BX537254.7| Human DNA sequence from clone RP6-74O6 on chromosome 1 Contains the 3' end of the putative G-protein coupled receptor (SH120), a novel gene and four CpG islands, complete sequence Length = 121309 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 18132 ccccctgcccggccagccg 18114
>emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chromosome X, complete sequence Length = 86882 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 8989 ccccctgcccggccagccg 9007 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 8743 ccccctgcccggccagccg 8761
>emb|AL732374.14| Human DNA sequence from clone RP13-444K19 on chromosome X Contains a mitochondrial ribosomal protein S18C (MRPS18C) pseudogene, the 3' end of the gene for a novel protein similar to PHD finger protein 2 PHF2 and a CpG island, complete sequence Length = 224187 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 152943 ccccctgcccggccagccg 152961
>emb|BX004807.10| Human DNA sequence from clone RP11-565D17 on chromosome 1 Contains the 5' end of the ITGB3BP gene for integrin beta 3 binding protein (beta3-endonexin), the 5' end of a novel gene (KIAA1799) and a CpG island, complete sequence Length = 78203 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 24764 ccccctgcccggccagccg 24782
>emb|AL935026.4| Human DNA sequence from clone DAQB-109B10 on chromosome 6 Contains the HLA-DQA1 gene for the major histocompatibility complex, class II, DQ alpha 1 protein, the HLA-DQB1 gene for major histocompatibility complex, class II, DQ beta 1 protein and one CpG island, complete sequence Length = 39179 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 16500 ccccctgcccggccagccg 16482
>emb|AL662924.24| Human DNA sequence from clone RP11-108J9 on chromosome 1 Contains the 3' end of the CLIC4 gene for chloride intracellular channel 4 and three CpG islands, complete sequence Length = 82931 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 49941 ccccctgcccggccagccg 49923 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 49415 ccccctgcccggccagccg 49397 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 49366 ccccctgcccggccagccg 49348 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 16434 ccccctgcccggccagccg 16452
>emb|AL662789.11| Human DNA sequence from clone XXbac-254F23 on chromosome 6 contains the 5' end of the HLA-DRB1 gene for major histocompatibility complex, class II, DR beta 1, the HLA-DQA1 gene for major histocompatibility complex, class II, DQ alpha 1, the HLA-DQB1 gene for major histocompatibility complex, class II, DQ beta 1, a cytochrome C oxidase polypeptide III pseudogene, a major histocompatibility complex, class II, beta polypeptide pseudogene and two CpG islands, complete sequence Length = 147557 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7795 ccccctgcccggccagccg 7777 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7342 ccccctgcccggccagccg 7324 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7063 ccccctgcccggccagccg 7045 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 6705 ccccctgcccggccagccg 6687
>emb|AL607022.11| Human DNA sequence from clone RP11-323N10 on chromosome 10 Contains the 5' end of the gene for alpha-catenin-like protein (MGC26194) (VR22), a aldo-keto reductase family 1, member B10 (aldose reductase) (AKR1B10) pseudogene and a CpG island, complete sequence Length = 121210 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 61183 ccccctgcccggccagccg 61201
>emb|AL672220.6| Human DNA sequence from clone RP11-17C2 on chromosome 1 Contains a CpG island, complete sequence Length = 104417 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 15528 ccccctgcccggccagccg 15510
>emb|AL645939.6| Human DNA sequence from clone XXbac-170G13 on chromosome 6 contains two P5-1 pseudogenes, the HLA-F gene for major histocompatibility complex, class I, F, a ribosomal protein L23A (RPL23A) pseudogene, a MHC class 1 polypeptide-related sequence B (MICB) pseudogene, a HCGIX pseudogene, a interferon-induced transmembrane protein 3 (IFITM3) pseudogene, a HLA (MHC class 1) pseudogene, a putative novel MHC class 1 (HLA) protein, a 60S ribosomal protein L7A (RPL7A) pseudogene and five CpG islands, complete sequence Length = 123768 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 16233 ccccctgcccggccagccg 16251
>emb|AL603890.14| Human DNA sequence from clone RP11-584P2 on chromosome 1 Contains the 3' end of a novel gene similar to preferentially expressed antigen in melanoma (PRAME), two novel proteins similar to preferentially expressed antigen in melanoma (PRAME), a novel gene and a CpG island, complete sequence Length = 88806 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 32558 ccccctgcccggccagccg 32576
>emb|AL596210.20| Human DNA sequence from clone RP11-92O17 on chromosome 1 Contains part of the CAMTA1 gene for calmodulin binding transcription activator 1, complete sequence Length = 107112 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 47413 ccccctgcccggccagccg 47395
>emb|AL606491.19| Human DNA sequence from clone RP11-70P17 on chromosome 1 Contains the 3' end of the gene for LDL receptor adaptor protein (ARH) and a novel gene, complete sequence Length = 49875 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 42038 ccccctgcccggccagccg 42056
>emb|AL606477.11| Human DNA sequence from clone RP11-190H11 on chromosome 1 Contains the 5' end of the gene for HP1-BP74, the 3' end of the EIF4G3 gene for eukaryotic translation initiation factor 4 gamma, 3 and three CpG islands, complete sequence Length = 139961 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 61232 ccccctgcccggccagccg 61250 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 60833 ccccctgcccggccagccg 60851
>emb|AL592046.7| Human DNA sequence from clone RP11-155O24 on chromosome X Contains part of the gene for upstream regulatory element binding protein 1 (UREB1) and a CpG island, complete sequence Length = 86196 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 43986 ccccctgcccggccagccg 44004
>emb|AL590640.19| Human DNA sequence from clone RP11-40H20 on chromosome 1 Contains the 5' end of the SLC9A1 gene for solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive), a ribosomal protein L18a (RPL18A) pseudogene, a novel pseudogene (FLJ20420), a nucleophosmin (nucleolar phosphoprotein B23, numatrin)(NPM1) pseudogene, a mall nuclear ribonucleoprotein polypeptide E (SNRPE) pseudogene, a novel gene, the 5' end of a novel gene (KIAA1037) and a CpG island, complete sequence Length = 147052 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 9425 ccccctgcccggccagccg 9443
>emb|AL591043.11| Human DNA sequence from clone RP11-357J22 on chromosome 1 Contains a proteolipid protein 2 (colonic epithelium-enriched) (PLP2) pseudogene, a mortality factor 4 (MORF4) pseudogene and a CPG island, complete sequence Length = 147109 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 93061 ccccctgcccggccagccg 93043
>emb|AL589843.9| Human DNA sequence from clone RP11-535M15 on chromosome 9 Contains a novel gene, a makorin, ring finger protein, 2 (MKRN2) pseudogene, a novel gene (KIAA0972) and five CpG islands, complete sequence Length = 142527 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 47938 ccccctgcccggccagccg 47920
>emb|AL512284.20| Human DNA sequence from clone RP11-248M22 on chromosome 10 Contains part of the gene for CamKI-like protein kinase (CKLiK) (LOC221042 LOC283070) and two CpG islands, complete sequence Length = 113920 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 72966 ccccctgcccggccagccg 72948 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 72567 ccccctgcccggccagccg 72549
>emb|AL512422.19| Human DNA sequence from clone RP11-472M19 on chromosome 6 Contains part of the BPAG1 gene for bullous pemphigoid antigen 1 (230/240kD), a novel gene, a ribosomal protein L17 (RPL17) pseudogene and three CpG islands, complete sequence Length = 157918 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 120139 ccccctgcccggccagccg 120121 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 119737 ccccctgcccggccagccg 119719
>emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on chromosome 10 Contains the 3' end of a breast cancer antigen (NY-BR-1) pseudogene, the 3' end of a novel gene, a pseudogene similar to part of cubilin (intrinsic factor-cobalamin receptor, CUBN), a seven transmembrane helix receptor (FLJ31393) pseudogene, the OR13A1 gene for olfactory receptor family 13 subfamily A member 1 and two CpG islands, complete sequence Length = 168473 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 87151 ccccctgcccggccagccg 87169
>emb|AL513044.13| Human DNA sequence from clone RP11-187D4 on chromosome 1 Contains a CpG island, complete sequence Length = 111901 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 86945 ccccctgcccggccagccg 86963 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 86818 ccccctgcccggccagccg 86836 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 86642 ccccctgcccggccagccg 86660
>emb|AL513314.12| Human DNA sequence from clone RP11-358H9 on chromosome 1 Contains a novel gene, a capicua homolog (Drosophila) (CIC) pseudogene and a CpG island, complete sequence Length = 58205 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 48607 ccccctgcccggccagccg 48625
>emb|AL512504.9| Human DNA sequence from clone RP11-325E14 on chromosome X Contains a heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRPH3) pseudogene, a WW domain binding protein 11 (WBP11) pseudogene, a hexokinase 2 (HK2) pseudogene, a proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1) pseudogene, the 3' end of the gene for a novel WD repeat domain protein and three CpG islands, complete sequence Length = 223078 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 213920 ccccctgcccggccagccg 213938
>emb|AL512449.6| Human DNA sequence from clone RP11-286E7 on chromosome 1 Contains part of the RPS6KC1 gene for ribosomal protein S6 kinase 52kDa polypeptide 1 and a CpG island, complete sequence Length = 176690 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 87741 ccccctgcccggccagccg 87723 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 86406 ccccctgcccggccagccg 86388
>emb|AL450309.14| Human DNA sequence from clone RP11-478H16 on chromosome 1 Contains the 5' end of the ERO1LB gene for ERO1-like beta (S. cerevisiae), an FK506 binding protein 3, 25kDa (FKBP3) pseudogene, the 5' UTR of a variant of the EDARADD gene for EDAR-associated death domain and three CpG islands, complete sequence Length = 166647 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 160915 ccccctgcccggccagccg 160933
>emb|AL445205.14| Human DNA sequence from clone RP11-24J23 on chromosome 1 Contains a novel gene (FLJ38972), the 3' end of the ROR1 gene for receptor tyrosine kinase-like orphan receptor 1, the 5' end of gene MGC35130 and a CpG island, complete sequence Length = 115936 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 106030 ccccctgcccggccagccg 106048
>emb|AL442646.14| Human DNA sequence from clone RP11-322A17 on chromosome X Contains a novel pseudogene and a lactate dehydrogenase B pseudogene, complete sequence Length = 155885 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7485 ccccctgcccggccagccg 7467 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7336 ccccctgcccggccagccg 7318 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 6980 ccccctgcccggccagccg 6962
>emb|AL442071.30| Human DNA sequence from clone RP11-420K8 on chromosome 1 Contains part of the MACF1 gene for microtubule-actin crosslinking factor 1, a novel gene, a heat shock 10kDa protein 1 (chaperonin 10) (HSPE1) pseudogene and a CpG island, complete sequence Length = 121295 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 8328 ccccctgcccggccagccg 8310
>emb|AL445427.23| Human DNA sequence from clone RP5-1091A7 on chromosome 1p22.2-31.1 Contains the 5' end of the COL24A1 gene for collagen type XXIV alpha 1 and two CpG islands, complete sequence Length = 111132 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 69247 ccccctgcccggccagccg 69265 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 69118 ccccctgcccggccagccg 69136
>emb|AL391809.21| Human DNA sequence from clone RP11-47A4 on chromosome 1 Contains the 5' end of the RYR2 gene for ryanodine receptor 2 (cardiac) and three CpG islands, complete sequence Length = 167548 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 87360 ccccctgcccggccagccg 87342
>emb|AL445426.20| Human DNA sequence from clone RP11-62J10 on chromosome 1 Contains the 3' end of a novel gene and a CpG island, complete sequence Length = 159117 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 155177 ccccctgcccggccagccg 155195
>emb|AL450332.19| Human DNA sequence from clone RP11-138M12 on chromosome 6 Contains part of a novel gene, complete sequence Length = 174678 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 14038 ccccctgcccggccagccg 14020
>emb|AL392104.19| Human DNA sequence from clone RP11-324E23 on chromosome 10 Contains the 3' end of a novel gene (DKFZp761L0424) (KIAA1217), the 3' end of the gene for Rho-GTPase activating protein 10 (ARHGAP10) and a CpG island, complete sequence Length = 166643 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 114374 ccccctgcccggccagccg 114392 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 114196 ccccctgcccggccagccg 114214
>emb|AL392107.17| Human DNA sequence from clone RP11-114F7 on chromosome 10 Contains the 3' end of the ABCC2 gene for ATP-binding cassette sub-family C (CFTR/MRP) member 2, gene KIAA1010 and two CpG islands, complete sequence Length = 95018 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 83548 ccccctgcccggccagccg 83566 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 83294 ccccctgcccggccagccg 83312 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 30451 ccccctgcccggccagccg 30433 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 29694 ccccctgcccggccagccg 29676 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 29467 ccccctgcccggccagccg 29449
>emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on chromosome 9 Contains part of the CDK5RAP2 gene for CDK5 regulatory subunit associated protein 2 (C48) and a CpG island, complete sequence Length = 46372 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 42796 ccccctgcccggccagccg 42814 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 42696 ccccctgcccggccagccg 42714
>emb|AL442123.12| Human DNA sequence from clone RP11-175O19 on chromosome 10 Contains the 3' end of the MLR2 gene for a novel protein (likely ortholog of mouse transcription factor MLR2), the gene for a novel protein novel protein (DKFZP564P1916)(FLJ13022), the 3' end of the SLIT1 gene for slit homolog 1 (Drosophila) and a CpG island, complete sequence Length = 96660 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 5867 ccccctgcccggccagccg 5849
>emb|AL392088.12| Human DNA sequence from clone RP5-964H19 on chromosome 1 Contains the 3' end of the gene for a novel protein similar to FLJ32883 containing DUF1220 domains, a suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) (ST13) pseudogene, a novel pseudogene and two CpG islands, complete sequence Length = 74877 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 25331 ccccctgcccggccagccg 25313 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 24427 ccccctgcccggccagccg 24409
>emb|AL445587.10| Human DNA sequence from clone RP11-429D3 on chromosome 9 Contains part of a novel gene (LOC158135) and a CpG island, complete sequence Length = 173062 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 121743 ccccctgcccggccagccg 121761
>emb|AL445492.10| Human DNA sequence from clone RP11-137O18 on chromosome 10 Contains part of the gene for VPS10 domain receptor protein SORCS 3 (SORCS3), complete sequence Length = 149248 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 58874 ccccctgcccggccagccg 58856
>emb|AL445465.10| Human DNA sequence from clone RP11-415D17 on chromosome 6 Contains two novel genes, part of a novel gene, a ubiquitin-conjugating enzyme E2 family pseudogene and a CpG island, complete sequence Length = 126388 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 89997 ccccctgcccggccagccg 89979
>emb|AL392103.6| Human DNA sequence from clone RP11-477L16 on chromosome 10 Contains a pseudogene similar to part of nuclease sensitive element binding protein 1 (NSEP1, part of the gene for SEC15 (S. cerevisiae)-like (SEC15L), and one CpG island, complete sequence Length = 125087 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 123059 ccccctgcccggccagccg 123077
>emb|AL365179.30| Human DNA sequence from clone RP13-34C21 on chromosome Xq24-25 Contains a chromobox homolog 1 (HP1 beta homolog Drosophila) (CBX1) pseudogene and a CpG island, complete sequence Length = 180851 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 44376 ccccctgcccggccagccg 44394
>emb|AL365182.27| Human DNA sequence from clone RP11-560O15 on chromosome 1 Contains a protein phosphatase 1, regulatory (inhibitor) subunit 11 (PPP1R11) pseudogene and a CpG island, complete sequence Length = 56883 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 34779 ccccctgcccggccagccg 34797 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 34557 ccccctgcccggccagccg 34575 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 34430 ccccctgcccggccagccg 34448 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 34209 ccccctgcccggccagccg 34227 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 34082 ccccctgcccggccagccg 34100
>emb|AL390729.23| Human DNA sequence from clone RP3-522D1 on chromosome 1 Contains the 5' end of a novel gene, a novel gene, a ribosomal protein L39 (RPL39) pseudogene and a CpG island, complete sequence Length = 69656 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 58487 ccccctgcccggccagccg 58469
>emb|AL390715.23| Human DNA sequence from clone RP11-167O6 on chromosome 10 Contains the ARHGAP12 gene for Rho GTPase activating protein 12 and two CpG islands, complete sequence Length = 189161 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 182747 ccccctgcccggccagccg 182765
>emb|AL390879.20| Human DNA sequence from clone RP11-308D16 on chromosome Xq25-27.1 Contains the 3' end of a novel gene, a serine/arginine repetitive matrix 1 (SRRM1) pseudogene (LOC347480), the GPR101 gene for G protein-coupled receptor 101 and four CpG islands, complete sequence Length = 172280 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 80451 ccccctgcccggccagccg 80433 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 80175 ccccctgcccggccagccg 80157
>emb|AL360169.17| Human DNA sequence from clone RP11-732M18 on chromosome 6 Contains the 5' end of the gene for tubby super-family protein (TUSP, KIAA1397), a novel gene, part of a novel gene and two CpG islands, complete sequence Length = 180635 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 168062 ccccctgcccggccagccg 168080
>emb|AL365443.16| Human DNA sequence from clone RP11-219C24 on chromosome 1 Contains six novel genes similar to preferentially expressed antigen in melanoma (PRAME), two novel genes, two preferentially expressed antigen in melanoma (PRAME) pseudogenes and a CpG island, complete sequence Length = 184591 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 122564 ccccctgcccggccagccg 122546
>emb|AL365190.16| Human DNA sequence from clone RP11-512H14 on chromosome 9 Contains the 5' end of the TLE1 gene for transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1), the 5' end of a novel gene and two CpG isalnds, complete sequence Length = 89468 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 84865 ccccctgcccggccagccg 84883
>emb|AL391379.12| Human DNA sequence from clone RP13-171J5 on chromosome X Contains a CpG island, complete sequence Length = 116800 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 34391 ccccctgcccggccagccg 34373
>emb|AL356968.41| Human DNA sequence from clone RP11-329A14 on chromosome 1 Contains the 5' end of the SPATA6 gene for spermatogenesis associated 6, an amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 (ALS2CR2) pseudogene, a ribosomal protein L21 (RPL21) pseudogene and a CpG island, complete sequence Length = 173373 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 56548 ccccctgcccggccagccg 56530
>emb|AL359388.32| Human DNA sequence from clone RP11-445I23 on chromosome 10 Contains the 5' end of the MMS19L gene for MMS19-like (MET18 homolog, S. cerevisiae), the gene for a novel protein (FLJ11807), the 5' end of the ANKRD2 gene for ankyrin repeat domain 2 (stretch responsive muscle) and two CpG islands, complete sequence Length = 86299 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 41599 ccccctgcccggccagccg 41581 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 41375 ccccctgcccggccagccg 41357
>emb|AL359385.28| Human DNA sequence from clone RP11-375N9 on chromosome 10 Contains the gene for a novel protein (MGC14258), a CD164 antigen, sialomucin (CD164) pseudogene and two CpG islands, complete sequence Length = 99408 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 76127 ccccctgcccggccagccg 76145
>emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chromosome 6 Contains the CDYL gene for a Y chromosome-like chromodomain protein, a ribosomal protein S18 (RPS18) pseudogene, the gene for ribonuclease P 40kD subunit (RPP40) and CpG islands, complete sequence Length = 166863 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 143806 ccccctgcccggccagccg 143788
>emb|AL358074.22| Human DNA sequence from clone RP11-423C15 on chromosome 9 Contains the 5' end of the MAPKAP1 gene for mitogen-activated protein kinase associated protein 1, a novel gene, the 5' end of the PBX3 gene for pre-B-cell leukemia transcription factor 3 and three CpG islands, complete sequence Length = 109081 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 98477 ccccctgcccggccagccg 98459
>emb|AL357125.22| Human DNA sequence from clone RP11-293D12 on chromosome 10 Contains part of the EGR2 gene for early growth response 2 (Krox-20 homolog, Drosophila), complete sequence Length = 116948 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 84050 ccccctgcccggccagccg 84068
>emb|AL358072.21| Human DNA sequence from clone RP11-188D8 on chromosome 1 Contains the 5' end of the MAN1A2 gene for mannosidase alpha class 1A member 2 and two CpG islands, complete sequence Length = 129725 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 70698 ccccctgcccggccagccg 70680
>emb|AL356970.21| Human DNA sequence from clone RP11-465E14 on chromosome 6, complete sequence Length = 53086 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 19347 ccccctgcccggccagccg 19329
>emb|AL357514.19| Human DNA sequence from clone RP1-105O18 on chromosome 6 Contains a novel gene and a CpG island, complete sequence Length = 140630 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 33666 ccccctgcccggccagccg 33648
>emb|AL357055.18| Human DNA sequence from clone RP11-389O22 on chromosome 1 Contains the 3' end of a novel gene, the 5' end of a novel gene, the LRIG2 gene for leucine-rich repeats and immunoglobulin-like domains 2, a ring finger protein 12 (RNF12) pseudogene, a ribosomal protein S19 (RPS19) pseudogene, a ribosomal protein S15 (RPS15) pseudogene and a CpG island, complete sequence Length = 188812 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 42914 ccccctgcccggccagccg 42932 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 42724 ccccctgcccggccagccg 42742
>emb|AL359512.15| Human DNA sequence from clone RP11-163B6 on chromosome 9 Contains the PDCL gene for phosducin-like, a keratin 18 (KRT18) pseudogene, the 3' end of the gene for membrane-associated nucleic acid binding protein (MNAB) (FLJ23389 FLJ20301 FLJ20713) the gene for a novel olfactory (seven transmembrane helix) receptor and two CpG islands, complete sequence Length = 58884 Score = 38.2 bits (19), Expect = 7.7 Identities = 25/27 (92%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccgacctgacc 45 ||||| ||||||||||||| ||||||| Sbjct: 55459 cccccggcccggccagccgccctgacc 55485
>gb|AC021028.12| Homo sapiens chromosome 10 clone RP11-137H2, complete sequence Length = 161803 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 127962 ccccctgcccggccagccg 127980
>gb|AC116533.11| Homo sapiens chromosome 11, clone RP11-466H18, complete sequence Length = 189143 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 105590 ccccctgcccggccagccg 105608 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 105461 ccccctgcccggccagccg 105479
>emb|AL355855.23| Human DNA sequence from clone RP11-302L10 on chromosome 6 Contains the 5' end of the NUDT3 gene for nudix (nucleoside diphosphate linked moiety X)-type motif 3 and CpG islands, complete sequence Length = 29442 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 12964 ccccctgcccggccagccg 12982 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 12913 ccccctgcccggccagccg 12931
>emb|AL356292.21| Human DNA sequence from clone RP11-363I22 on chromosome 1 Contains the 5' end of the gene for GPP34-related protein (GPP34R), the gene for a novel protein (DKFZp434A1315), the CTSS gene for cathepsin S, a pseudogene similar to part of short coiled-coil protein (SCOC) and the 3' end of the CTSK gene for cathepsin K (pycnodysostosis), complete sequence Length = 154068 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 134576 ccccctgcccggccagccg 134594
>emb|AL356652.19| Human DNA sequence from clone RP11-42O4 on chromosome 20 Contains part of the gene for a novel glycosyl hydrolase family 47 protein and the PROCR gene for endothelial protein C receptor (EPCR), complete sequence Length = 50217 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 14272 ccccctgcccggccagccg 14290
>emb|AL355861.19| Human DNA sequence from clone RP11-567J24 on chromosome 10 Contains the 5' end of a novel gene, the PRDX3 gene for peroxiredoxin 3 (AOP1, MER5, AOP-1, SP-22), the 5' end of the GPRK5 gene for G protein-coupled receptor kinase 5 (GRK5), a novel gene and four CpG islands, complete sequence Length = 168528 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 101963 ccccctgcccggccagccg 101945
>emb|AL356750.16| Human DNA sequence from clone RP11-374F3 on chromosome 13 Contains the KATNAL1 gene for katanin p60 subunit A-like 1, a peroxiredoxin 2 (PRDX2) pseudogene, two novel genes and two CpG islands, complete sequence Length = 182303 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 71430 ccccctgcccggccagccg 71448
>emb|AL355535.14| Human DNA sequence from clone RP11-494N1 on chromosome 9 Contains the 5' end of the GNA14 gene for guanine nucleotide binding protein (G protein) alpha 14, the 3' end of the GNAQ gene for guanine nucleotide binding protein (G protein) q polypeptide and two CpG islands, complete sequence Length = 186658 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 176476 ccccctgcccggccagccg 176494
>emb|AL355802.13| Human DNA sequence from clone RP3-337H4 on chromosome 6 Contains the 3' part of a novel gene, three novel genes, the gene for RNA polymerase I 40 kDa subunit (RPA40) (RPA39), the gene for exportin 5 (KIAA1291) (XPO5), a 40S ribosomal protein S2 (RPS2) pseudogene, the 5' part of the POLH gene for DNA directed polymerase eta and four CpG islands, complete sequence Length = 105935 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 93421 ccccctgcccggccagccg 93403
>emb|AL354989.13| Human DNA sequence from clone RP11-537H15 on chromosome 9 Contains the 5' end of a novel gene (KIAA1491, FLJ22435 FLJ21704, FLJ22148), two novel genes (including DKFZP434O125 (KIAA1892, FLJ20347)), a tubulin beta pseudogene, an IMP (inosine monophosphate) dehydrogenase 1 (IMPDH1) pseudogene and four CpG islands, complete sequence Length = 151990 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 150023 ccccctgcccggccagccg 150041
>emb|AL355305.9| Human DNA sequence from clone RP11-487F23 on chromosome 6 Contains the 5' end of the gene for p53 regulated PA26 nuclear protein (PA26-T1), a novel gene and part of a novel gene, complete sequence Length = 185257 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 11307 ccccctgcccggccagccg 11325 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 11180 ccccctgcccggccagccg 11198 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 10829 ccccctgcccggccagccg 10847
>emb|AL354808.24| Human DNA sequence from clone RP11-523H24 on chromosome 13 Contains the 3' end of a novel gene, the gene for paraspeckle protein 1 (PSP1) (FLJ10955), two novel genes, a sialyltransferase 7D (SIAT7D) pseudogene, the 3' end of a variant of the ZNF237 gene for zinc finger protein 237 and two CpG islands, complete sequence Length = 169303 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 114924 ccccctgcccggccagccg 114942
>emb|AL354707.17| Human DNA sequence from clone RP11-390F4 on chromosome 9 Contains the 5' end of a ring finger protein 2 (RNF2) pseudogene, the 3' end of a novel gene, a 60S ribosomal protein L35a (RPL35A) pseudogene, three novel genes, a gene similar to small nuclear ribonucleoprotein polypeptide E (SNRPE), the 5' end of the JMJD2C gene for jumonji domain containing 2C, a chromosome 20 open reading frame 45 (C20orf45) pseudogene and six CpG islands, complete sequence Length = 170970 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 140313 ccccctgcccggccagccg 140331
>emb|AL353700.14| Human DNA sequence from clone RP3-350J21 on chromosome 6 Contains part of the DNAH8 gene for dynein axonemal heavy polypeptide 8 and the 5' part of a novel gene, complete sequence Length = 56509 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 17900 ccccctgcccggccagccg 17882
>emb|AL162498.12| Human DNA sequence from clone RP11-315A9 on chromosome 13 Contains a CpG island, complete sequence Length = 24565 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 1811 ccccctgcccggccagccg 1793
>emb|AL354798.13| Human DNA sequence from clone RP11-756A22 on chromosome 13 Contains the 3' end of a novel gene, the CENJP gene for centromere protein J (LAP, CPAP, LIP1, BM032), 2 novel genes, a pseudogene similar to part of solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 (SLC25A15), a TPTE and PTEN homologous inositol lipid phosphatase (TPIP) pseudogene, a 60S ribisomal protein L34 (RPL34) pseudogene and 2 CpG islands, complete sequence Length = 167319 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 132062 ccccctgcccggccagccg 132044
>emb|AL162584.9| Human DNA sequence from clone RP11-12A16 on chromosome 9 Contains part of the MAPKAP1 gene for mitogen-activated protein kinase associated protein 1, a novel gene, a heterogeneous nuclear ribonucleoprotein A1 (HNRP1) pseudogene and two CpG islands, complete sequence Length = 160178 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 101220 ccccctgcccggccagccg 101238
>emb|AL161652.25| Human DNA sequence from clone RP11-543N17 on chromosome 10 Contains the 3' end of a novel gene (FLJ20445) and a MAP/microtubule affinity-regulating kinase 2 (MARK2) pseudogene, complete sequence Length = 156949 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 82254 ccccctgcccggccagccg 82272 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 81639 ccccctgcccggccagccg 81657 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 81279 ccccctgcccggccagccg 81297
>emb|AL162411.23| Human DNA sequence from clone RP11-106A1 on chromosome 9 Contains the 5' end of the GLDC gene for glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P), a ribosomal protein L23a (RPL23A) pseudogene, a ribosomal protein S3A (RPS3A) pseudogene, the 3' end of a ring finger protein 2 (RNF2) pseudogene, the 5' end of a novel gene and 3 CpG islands, complete sequence Length = 59964 Score = 38.2 bits (19), Expect = 7.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 20 cccctgcccggccagccgacctg 42 |||||||||||||||||| |||| Sbjct: 13278 cccctgcccggccagccgccctg 13300
>emb|AL158209.23| Human DNA sequence from clone RP11-275N1 on chromosome 10 Contains a novel gene and a pseudogene similar to part of FLJ10581, complete sequence Length = 132327 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 92312 ccccctgcccggccagccg 92330
>emb|AL160260.22| Human DNA sequence from clone RP11-519H8 on chromosome 6 Contains a CpG island, complete sequence Length = 75778 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 12814 ccccctgcccggccagccg 12796 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 12493 ccccctgcccggccagccg 12475
>emb|AL162389.21| Human DNA sequence from clone RP11-380I20 on chromosome 9 Contains a small EDRK-rich factor 2 (SERF2) pseudogene, a ribosomal protein L36a pseudogene 6 (RPL36AP6) and two CpG islands, complete sequence Length = 157017 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 64288 ccccctgcccggccagccg 64306 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 64110 ccccctgcccggccagccg 64128 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 63932 ccccctgcccggccagccg 63950 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 63881 ccccctgcccggccagccg 63899 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 63703 ccccctgcccggccagccg 63721
>emb|AL161656.20| Human DNA sequence from clone RP11-12M19 on chromosome 20 Contains the C20orf81 gene, the VSP16 gene for vacuolar protein sorting 16 (yeast), the 5' end of the PTPRA gene for protein tyrosine phosphatase receptor type A and four CpG islands, complete sequence Length = 103370 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 5165 ccccctgcccggccagccg 5183
>emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on chromosome 20 Contains the PPIP11 gene for peptidylprolyl isomerase (cyclophilin) pseudogene 11 and a CpG island, complete sequence Length = 81304 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 66757 ccccctgcccggccagccg 66739
>emb|AL160157.17| Human DNA sequence from clone RP11-547C18 on chromosome 13 Contains the 5' end of the GUCY1B2 gene for guanylate cyclase 1 soluble beta 2 and part of a novel gene, complete sequence Length = 127227 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 78470 ccccctgcccggccagccg 78488
>emb|AL161802.15| Human DNA sequence from clone RP11-96L6 on chromosome 20 Contains the 5' part of the KIAA0980 gene ESTs, STSs, GSSs and two CpG islands, complete sequence Length = 57115 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 25609 ccccctgcccggccagccg 25627
>emb|AL160032.14| Human DNA sequence from clone RP11-474L7 on chromosome 13 Contains the 3' end of the KLF12 gene for Kruppel-like factor 12, a novel gene and the 5' end of a novel gene and a CpG island, complete sequence Length = 181324 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 48111 ccccctgcccggccagccg 48129 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 48011 ccccctgcccggccagccg 48029
>emb|AL161716.14| Human DNA sequence from clone RP11-266E6 on chromosome 13 Contains the 3' end of a novel gene, a guanidinoacetate N-methyltransferase (GAMT) pseudogene and a CpG island, complete sequence Length = 164345 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 18481 ccccctgcccggccagccg 18499
>emb|AL162416.13| Human DNA sequence from clone RP11-296H15 on chromosome 9 Contains the 3' end of the TMC1 gene for transmembrane cochlear-expressed 1 and three CpG islands, complete sequence Length = 75609 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 45181 ccccctgcccggccagccg 45163 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 10926 ccccctgcccggccagccg 10908
>emb|AL158014.20| Human DNA sequence from clone RP11-88I10 on chromosome 10q25.2-26.2 Contains the 5' end of a novel gene, the 5' end of the SAC2 gene for Sac domain-containing inositol phosphatase 2 and three CpG islands, complete sequence Length = 114244 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 38491 ccccctgcccggccagccg 38509
>emb|AL158206.8| Human DNA sequence from clone RP11-363E7 on chromosome 9 Contains the 3' end of a novel gene, possible ortholog of mouse cancer related gene-liver 1 (CRG-L1), a tmicortubule-associated protein pseudogene, the 3' end of the SLC24A2 gene for solute carrier family 24 (sodium/potassium/calcium exchanger) member 2 (NCKX2) and 2 CpG islands, complete sequence Length = 163542 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 830 ccccctgcccggccagccg 812
>emb|AL139811.30| Human DNA sequence from clone RP11-75A9 on chromosome Xp11.23-11.4 Contains a catenin, beta like 1 (NAP, P14L, C20orf33, FLJ21108, NYD-SP19) (CTNNBL1) pseudogene, a glyceraldehyde-3-phosphate dehydrogenase (G3PD, GAPDH) (GAPD) pseudogene, a transmembrane protein vezatin pseudogene, a novel gene (FLJ20344) and two CpG islands, complete sequence Length = 141469 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 57033 ccccctgcccggccagccg 57015 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 56632 ccccctgcccggccagccg 56614
>gb|AC104010.21| Homo sapiens chromosome 11, clone RP11-244C20, complete sequence Length = 63480 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 28678 ccccctgcccggccagccg 28660
>gb|AC099558.2| Homo sapiens chromosome 3 clone RP11-680P23, complete sequence Length = 180049 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 107142 ccccctgcccggccagccg 107160
>emb|AL139326.15| Human DNA sequence from clone RP11-351K3 on chromosome 13 Contains the 3' end of the COG3 gene for component of oligomeric golgi complex 3, a novel gene (FLJ32682),a translocase of inner mitochondrial membrane 9 homolog (yeast) (TIMM9) pseudogene and a CpG island, complete sequence Length = 175588 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 17986 ccccctgcccggccagccg 17968
>emb|AL138955.14| Human DNA sequence from clone RP11-10E18 on chromosome 13 Contains the 5' UTR of the gene for novel zinc-finger protein (DZIP1, KIAA0996), the 3' end of the DNAJC3 gene for DnaJ (Hsp40) homolog, subfamily C, member 3, a pseudogene similar to part of NADH dehydrogenase 5 (MTND5) , a novel cytochrome B pseudogene, a NADH dehydrogenase 6 (MTND6) pseudogene and 4 CpG islands, complete sequence Length = 149704 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 47625 ccccctgcccggccagccg 47607
>emb|AL138921.14| Human DNA sequence from clone RP11-316M21 on chromosome 10 Contains the 3' end of gene FLJ30135, the CHUK gene for conserved helix-loop ubiquitous kinase, a novel gene (FLJ32012), a novel gene containing FLJ10998, FLJ40576, FLJ3922, FLJ30751, a prohibitin (PHB) pseudogene, a tropomyosin (TPM4) pseudogene and three CpG islands, complete sequence Length = 194916 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7859 ccccctgcccggccagccg 7877 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7680 ccccctgcccggccagccg 7698 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7655 ccccctgcccggccagccg 7673 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 7252 ccccctgcccggccagccg 7270
>emb|AL157877.11| Human DNA sequence from clone RP11-2P5 on chromosome 13 Contains the 5' end of a novel gene, the gene for suppressor of G2 allele of SKP1, S. cerevisiae, the 5' end of a gene similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP) , a pseudogene similar to part of regulator of G-protein signalling 17 (RGS17), the WBP4 gene for WW domain binding protein 4 (formin binding protein 21) and 4 CpG islands, complete sequence Length = 198567 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 atccccctgcccggccagc 35 ||||||||||||||||||| Sbjct: 60085 atccccctgcccggccagc 60103
>gb|AC008769.7| Homo sapiens chromosome 5 clone CTD-2006B8, complete sequence Length = 147305 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 139020 ccccctgcccggccagccg 139038
>emb|AL157777.5| Human DNA sequence from clone RP11-76H14 on chromosome 6 Contains the HTR1E gene for 5-hydroxytryptamine (serotonin) receptor, a pseudogene similar to the 5' end of ST13 (suppression of tumorigenicity 13, a Hsp70-interacting protein), a pseudogene similar to the 5' end of a Tec protein-tyrosine kinase, a pseudogene similar to 60S ribosomal protein L7,a pseudogene similar to the bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase mitochondria and two CpG islands, complete sequence Length = 169669 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 140335 ccccctgcccggccagccg 140317
>emb|AL138744.41| Human DNA sequence from clone RP13-257M1 on chromosome Xp11.23-11.4 Contains part of the UTX gene for ubiquitously transcribed tetratricopeptide repeat gene X chromosome and a CpG island, complete sequence Length = 143968 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 98809 ccccctgcccggccagccg 98791
>emb|AL135907.21| Human DNA sequence from clone RP1-257C19 on chromosome 6 Contains the 3' end of the gene for hypothetical protein FLJ14917 (contains FLJ13594), complete sequence Length = 45627 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 27727 ccccctgcccggccagccg 27745
>emb|AL137852.15| Human DNA sequence from clone RP11-131A5 on chromosome 9q32-34.11 Contains the RAD23B gene for RA23B homolog B (S. cerevisiae) and three CpG islands, complete sequence Length = 162509 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 18091 ccccctgcccggccagccg 18073
>gb|AC087442.13| Homo sapiens chromosome 11, clone RP11-495O11, complete sequence Length = 200269 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 163318 ccccctgcccggccagccg 163300
>emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chromosome 10 Contains the 3' end of the TACC2 gene for transforming, acidic coiled-coil containing protein 2 (AZU-1), the gene for a novel protein (FLJ25359) and two CpG islands, complete sequence Length = 213861 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 45411 ccccctgcccggccagccg 45393
>emb|AL135787.13| Human DNA sequence from clone RP11-16L21 on chromosome 9 Contains the 3' end of a variant of the gene for KIAA1962 protein similar to zinc finger protein HIT-10, the LTB4DH gene for leukotriene B4 12-hydroxydehydrogenase (MGC34943), the gene for KIAA0563-related gene (LOC286331), the GNG10 gene for guanine nucleotide binding protein (G protein), gamma 10, a novel gene, the 3' end of a novel gene and six CpG islands, complete sequence Length = 161448 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 84861 ccccctgcccggccagccg 84879
>emb|AL138728.12| Human DNA sequence from clone RP1-153N22 on chromosome 6q21-22.1 Contains a CpG island, complete sequence Length = 26999 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 9772 ccccctgcccggccagccg 9754
>gb|AC011401.9| Homo sapiens chromosome 5 clone CTB-35K5, complete sequence Length = 199275 Score = 38.2 bits (19), Expect = 7.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ccccctgcccggccagccg 37 ||||||||||||||||||| Sbjct: 135630 ccccctgcccggccagccg 135648 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,189,099 Number of Sequences: 3902068 Number of extensions: 1189099 Number of successful extensions: 86103 Number of sequences better than 10.0: 624 Number of HSP's better than 10.0 without gapping: 624 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 79743 Number of HSP's gapped (non-prelim): 6360 length of query: 160 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 138 effective length of database: 17,147,199,772 effective search space: 2366313568536 effective search space used: 2366313568536 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
