ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal9o14 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ251051.1|AFA251051 Avena fatua mRNA for VIP2 protein (vip2 gene) Length = 1724 Score = 379 bits (191), Expect = e-102 Identities = 281/311 (90%) Strand = Plus / Minus Query: 324 ggtgcgggtgtggattctgatgcgccatgagactgctgtgagctccaccagcttgtctca 383 ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1385 ggtgccggtgtggattctgatgcgccatgagactgctgtgagctccaccagcttgtctcg 1326 Query: 384 cagtcgactggcatcaatgggtacggcgcgaagcgatcgcgctcccaggcatagaatcgg 443 ||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 1325 cagtccactggcattaatgggtatggcgcgaagcgatcgcgctcccaggcatagaatcgg 1266 Query: 444 cttcctccagcctcatcagtatccattgaactatgaccggatgagcccggtgggaacagg 503 |||||||||| |||||||| |||||||||||||| |||||||| || |||||||||||| Sbjct: 1265 tttcctccagcgtcatcagtctccattgaactatggccggatgaacctggtgggaacagg 1206 Query: 504 caaaatgttgggttttccggttgaggtggcggaggggcaggtcgcatgcctcctgatcta 563 |||||||||||||| || |||||||| || || || ||||| ||||||||||| |||||| Sbjct: 1205 caaaatgttgggttctctggttgaggaggtggcggagcaggccgcatgcctcccgatcta 1146 Query: 564 tgagctccagcgaaaaggctggatgatgaactctgcgggtactgttcgttgatgctacca 623 || || || ||||||||||| || |||| | ||||| ||||||||||||||| ||| | | Sbjct: 1145 tgcgccccggcgaaaaggctagaagatggattctgcaggtactgttcgttgaggctgcta 1086 Query: 624 tgtgccctcat 634 ||||||||||| Sbjct: 1085 tgtgccctcat 1075 Score = 109 bits (55), Expect = 1e-20 Identities = 79/87 (90%) Strand = Plus / Minus Query: 215 ctacatccgaggagagtgcatttgtcgatacgatgagccctcgggtgatctattctcggg 274 |||||||||||||||||||||||||||||| |||| ||||||||| ||||| || || || Sbjct: 1506 ctacatccgaggagagtgcatttgtcgatatgatgtgccctcgggcgatctgttttcagg 1447 Query: 275 cgacgacctgccgaggccgatccactg 301 ||| |||| |||||||||||||||||| Sbjct: 1446 cgatgaccggccgaggccgatccactg 1420 Score = 107 bits (54), Expect = 4e-20 Identities = 134/153 (87%), Gaps = 7/153 (4%) Strand = Plus / Minus Query: 56 ctccaggttatttcatgtttctccct-tgcagaattctccggaag-ttcagcgcacaacc 113 |||||||||||||||||||||||||| ||||||||||||| || | |||| ||| ||||| Sbjct: 1654 ctccaggttatttcatgtttctccctctgcagaattctccagatgtttcaccgcgcaacc 1595 Query: 114 cggtttaaattccatacagatggttttttccccatcttttcttacaagcaactcaggttc 173 |||||| |||| |||||||| | |||| |||||| ||||||||||||||||||||||| Sbjct: 1594 cggttt-aattgcatacagacaggtttt--cccatcatttcttacaagcaactcaggttc 1538 Query: 174 -caaatgt-caagttttaacttaggttgcctct 204 |||| | ||||||||||||||||||||||| Sbjct: 1537 tgaaatatgaaagttttaacttaggttgcctct 1505
>ref|NM_185266.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1320 Score = 264 bits (133), Expect = 3e-67 Identities = 339/408 (83%), Gaps = 6/408 (1%) Strand = Plus / Minus Query: 230 gtgcatttgtcgatacgatgagccctcgggtgatctattctcgggcgacgacctgccgag 289 ||||||||| ||||||||||||||||||||||||| ||| || || || || || || | Sbjct: 1305 gtgcatttgccgatacgatgagccctcgggtgatcgattttccggagatgatcttccaac 1246 Query: 290 gccgatccactggccaaagagtctcctcggcgcaggtgcgggtgtggattctgatgcgcc 349 || ||||| || ||||| |||||||| || ||||| |||||| ||||||| || Sbjct: 1245 accaatccattgcccaaatagtctccttggagcaggcgcgggt------tctgatgtacc 1192 Query: 350 atgagactgctgtgagctccaccagcttgtctcacagtcgactggcatcaatgggtacgg 409 |||||| || ||||| ||||||||| ||||||||||||| |||||||| | |||||| || Sbjct: 1191 atgagattgttgtgaactccaccagtttgtctcacagtccactggcattagtgggtatgg 1132 Query: 410 cgcgaagcgatcgcgctcccaggcatagaatcggcttcctccagcctcatcagtatccat 469 ||||||||||| || |||||||||||||||||| ||||||| || |||||||| ||||| Sbjct: 1131 tgcgaagcgatcccgttcccaggcatagaatcggtttcctcctgcatcatcagtctccat 1072 Query: 470 tgaactatgaccggatgagcccggtgggaacaggcaaaatgttgggttttccggttgagg 529 || |||| || ||||| || |||||||| |||||||||| ||||| || ||| |||| Sbjct: 1071 cgagttatggccagatgaacctggtgggaaaaggcaaaatgccgggttctctggtagagg 1012 Query: 530 tggcggaggggcaggtcgcatgcctcctgatctatgagctccagcgaaaaggctggatga 589 ||||| || |||| |||||||||||||||||||||||| ||||| || | ||||||||| Sbjct: 1011 gggcggcggtgcagttcgcatgcctcctgatctatgagccccagcaaataagctggatga 952 Query: 590 tgaactctgcgggtactgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||| |||||||||| | ||||| || || ||||||||||| Sbjct: 951 tgaactctgctggtactgttcactaatgctgccgtgcgccctcatgaa 904
>gb|AC087551.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0431G05, complete sequence Length = 145044 Score = 264 bits (133), Expect = 3e-67 Identities = 339/408 (83%), Gaps = 6/408 (1%) Strand = Plus / Plus Query: 230 gtgcatttgtcgatacgatgagccctcgggtgatctattctcgggcgacgacctgccgag 289 ||||||||| ||||||||||||||||||||||||| ||| || || || || || || | Sbjct: 7411 gtgcatttgccgatacgatgagccctcgggtgatcgattttccggagatgatcttccaac 7470 Query: 290 gccgatccactggccaaagagtctcctcggcgcaggtgcgggtgtggattctgatgcgcc 349 || ||||| || ||||| |||||||| || ||||| |||||| ||||||| || Sbjct: 7471 accaatccattgcccaaatagtctccttggagcaggcgcgggt------tctgatgtacc 7524 Query: 350 atgagactgctgtgagctccaccagcttgtctcacagtcgactggcatcaatgggtacgg 409 |||||| || ||||| ||||||||| ||||||||||||| |||||||| | |||||| || Sbjct: 7525 atgagattgttgtgaactccaccagtttgtctcacagtccactggcattagtgggtatgg 7584 Query: 410 cgcgaagcgatcgcgctcccaggcatagaatcggcttcctccagcctcatcagtatccat 469 ||||||||||| || |||||||||||||||||| ||||||| || |||||||| ||||| Sbjct: 7585 tgcgaagcgatcccgttcccaggcatagaatcggtttcctcctgcatcatcagtctccat 7644 Query: 470 tgaactatgaccggatgagcccggtgggaacaggcaaaatgttgggttttccggttgagg 529 || |||| || ||||| || |||||||| |||||||||| ||||| || ||| |||| Sbjct: 7645 cgagttatggccagatgaacctggtgggaaaaggcaaaatgccgggttctctggtagagg 7704 Query: 530 tggcggaggggcaggtcgcatgcctcctgatctatgagctccagcgaaaaggctggatga 589 ||||| || |||| |||||||||||||||||||||||| ||||| || | ||||||||| Sbjct: 7705 gggcggcggtgcagttcgcatgcctcctgatctatgagccccagcaaataagctggatga 7764 Query: 590 tgaactctgcgggtactgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||| |||||||||| | ||||| || || ||||||||||| Sbjct: 7765 tgaactctgctggtactgttcactaatgctgccgtgcgccctcatgaa 7812
>gb|AC093492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0059G01, complete sequence Length = 141661 Score = 264 bits (133), Expect = 3e-67 Identities = 339/408 (83%), Gaps = 6/408 (1%) Strand = Plus / Plus Query: 230 gtgcatttgtcgatacgatgagccctcgggtgatctattctcgggcgacgacctgccgag 289 ||||||||| ||||||||||||||||||||||||| ||| || || || || || || | Sbjct: 116938 gtgcatttgccgatacgatgagccctcgggtgatcgattttccggagatgatcttccaac 116997 Query: 290 gccgatccactggccaaagagtctcctcggcgcaggtgcgggtgtggattctgatgcgcc 349 || ||||| || ||||| |||||||| || ||||| |||||| ||||||| || Sbjct: 116998 accaatccattgcccaaatagtctccttggagcaggcgcgggt------tctgatgtacc 117051 Query: 350 atgagactgctgtgagctccaccagcttgtctcacagtcgactggcatcaatgggtacgg 409 |||||| || ||||| ||||||||| ||||||||||||| |||||||| | |||||| || Sbjct: 117052 atgagattgttgtgaactccaccagtttgtctcacagtccactggcattagtgggtatgg 117111 Query: 410 cgcgaagcgatcgcgctcccaggcatagaatcggcttcctccagcctcatcagtatccat 469 ||||||||||| || |||||||||||||||||| ||||||| || |||||||| ||||| Sbjct: 117112 tgcgaagcgatcccgttcccaggcatagaatcggtttcctcctgcatcatcagtctccat 117171 Query: 470 tgaactatgaccggatgagcccggtgggaacaggcaaaatgttgggttttccggttgagg 529 || |||| || ||||| || |||||||| |||||||||| ||||| || ||| |||| Sbjct: 117172 cgagttatggccagatgaacctggtgggaaaaggcaaaatgccgggttctctggtagagg 117231 Query: 530 tggcggaggggcaggtcgcatgcctcctgatctatgagctccagcgaaaaggctggatga 589 ||||| || |||| |||||||||||||||||||||||| ||||| || | ||||||||| Sbjct: 117232 gggcggcggtgcagttcgcatgcctcctgatctatgagccccagcaaataagctggatga 117291 Query: 590 tgaactctgcgggtactgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||| |||||||||| | ||||| || || ||||||||||| Sbjct: 117292 tgaactctgctggtactgttcactaatgctgccgtgcgccctcatgaa 117339
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 264 bits (133), Expect = 3e-67 Identities = 339/408 (83%), Gaps = 6/408 (1%) Strand = Plus / Plus Query: 230 gtgcatttgtcgatacgatgagccctcgggtgatctattctcgggcgacgacctgccgag 289 ||||||||| ||||||||||||||||||||||||| ||| || || || || || || | Sbjct: 3129694 gtgcatttgccgatacgatgagccctcgggtgatcgattttccggagatgatcttccaac 3129753 Query: 290 gccgatccactggccaaagagtctcctcggcgcaggtgcgggtgtggattctgatgcgcc 349 || ||||| || ||||| |||||||| || ||||| |||||| ||||||| || Sbjct: 3129754 accaatccattgcccaaatagtctccttggagcaggcgcgggt------tctgatgtacc 3129807 Query: 350 atgagactgctgtgagctccaccagcttgtctcacagtcgactggcatcaatgggtacgg 409 |||||| || ||||| ||||||||| ||||||||||||| |||||||| | |||||| || Sbjct: 3129808 atgagattgttgtgaactccaccagtttgtctcacagtccactggcattagtgggtatgg 3129867 Query: 410 cgcgaagcgatcgcgctcccaggcatagaatcggcttcctccagcctcatcagtatccat 469 ||||||||||| || |||||||||||||||||| ||||||| || |||||||| ||||| Sbjct: 3129868 tgcgaagcgatcccgttcccaggcatagaatcggtttcctcctgcatcatcagtctccat 3129927 Query: 470 tgaactatgaccggatgagcccggtgggaacaggcaaaatgttgggttttccggttgagg 529 || |||| || ||||| || |||||||| |||||||||| ||||| || ||| |||| Sbjct: 3129928 cgagttatggccagatgaacctggtgggaaaaggcaaaatgccgggttctctggtagagg 3129987 Query: 530 tggcggaggggcaggtcgcatgcctcctgatctatgagctccagcgaaaaggctggatga 589 ||||| || |||| |||||||||||||||||||||||| ||||| || | ||||||||| Sbjct: 3129988 gggcggcggtgcagttcgcatgcctcctgatctatgagccccagcaaataagctggatga 3130047 Query: 590 tgaactctgcgggtactgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||| |||||||||| | ||||| || || ||||||||||| Sbjct: 3130048 tgaactctgctggtactgttcactaatgctgccgtgcgccctcatgaa 3130095
>dbj|AK111816.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013147K05, full insert sequence Length = 1537 Score = 264 bits (133), Expect = 3e-67 Identities = 339/408 (83%), Gaps = 6/408 (1%) Strand = Plus / Minus Query: 230 gtgcatttgtcgatacgatgagccctcgggtgatctattctcgggcgacgacctgccgag 289 ||||||||| ||||||||||||||||||||||||| ||| || || || || || || | Sbjct: 1297 gtgcatttgccgatacgatgagccctcgggtgatcgattttccggagatgatcttccaac 1238 Query: 290 gccgatccactggccaaagagtctcctcggcgcaggtgcgggtgtggattctgatgcgcc 349 || ||||| || ||||| |||||||| || ||||| |||||| ||||||| || Sbjct: 1237 accaatccattgcccaaatagtctccttggagcaggcgcgggt------tctgatgtacc 1184 Query: 350 atgagactgctgtgagctccaccagcttgtctcacagtcgactggcatcaatgggtacgg 409 |||||| || ||||| ||||||||| ||||||||||||| |||||||| | |||||| || Sbjct: 1183 atgagattgttgtgaactccaccagtttgtctcacagtccactggcattagtgggtatgg 1124 Query: 410 cgcgaagcgatcgcgctcccaggcatagaatcggcttcctccagcctcatcagtatccat 469 ||||||||||| || |||||||||||||||||| ||||||| || |||||||| ||||| Sbjct: 1123 tgcgaagcgatcccgttcccaggcatagaatcggtttcctcctgcatcatcagtctccat 1064 Query: 470 tgaactatgaccggatgagcccggtgggaacaggcaaaatgttgggttttccggttgagg 529 || |||| || ||||| || |||||||| |||||||||| ||||| || ||| |||| Sbjct: 1063 cgagttatggccagatgaacctggtgggaaaaggcaaaatgccgggttctctggtagagg 1004 Query: 530 tggcggaggggcaggtcgcatgcctcctgatctatgagctccagcgaaaaggctggatga 589 ||||| || |||| |||||||||||||||||||||||| ||||| || | ||||||||| Sbjct: 1003 gggcggcggtgcagttcgcatgcctcctgatctatgagccccagcaaataagctggatga 944 Query: 590 tgaactctgcgggtactgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||| |||||||||| | ||||| || || ||||||||||| Sbjct: 943 tgaactctgctggtactgttcactaatgctgccgtgcgccctcatgaa 896
>gb|AY108590.1| Zea mays PCO110089 mRNA sequence Length = 1070 Score = 206 bits (104), Expect = 7e-50 Identities = 241/286 (84%), Gaps = 3/286 (1%) Strand = Plus / Minus Query: 356 ctgctgtgagctccaccagcttgtctcacagtcgactggcatcaatgggtacggcgcgaa 415 |||||||||| ||||||||||| |||| ||||| || |||||||| || | || ||||| Sbjct: 377 ctgctgtgaggtccaccagcttatctcgcagtccacaggcatcaacggaaatggggcgaa 318 Query: 416 gcgatcgcgctcccaggcatagaatcggcttcctccagcctcatcagtatccattgaact 475 || || ||||||||||||||||| ||||||||||||| |||||||| ||||| ||||| Sbjct: 317 ccggtcacgctcccaggcatagaactggcttcctccagcgtcatcagtctccatcgaact 258 Query: 476 atgaccggatgagcccggtgggaacaggcaaaatgttgggttttccggttgaggtggcgg 535 ||| |||||||| ||||||||||||| | |||| || ||||| || ||| |||||| | Sbjct: 257 atggccggatgaacccggtgggaacaaggaaaaggtggggttctctggtagaggtgtc-- 200 Query: 536 aggggcaggtcgcatgcctcctgatctatgagctccagcgaaaaggctggatgatgaact 595 || |||||||||||||||||||| ||||| || ||||| || ||||| ||||||||| | Sbjct: 199 -ggcgcaggtcgcatgcctcctgacctatgtgccccagcaaataggctagatgatgaatt 141 Query: 596 ctgcgggtactgttcgttgatgctaccatgtgccctcatgaactga 641 ||| |||| ||||| |||||||| ||||| ||||||||||||||| Sbjct: 140 ctgttggtattgttcattgatgctgccatgggccctcatgaactga 95 Score = 79.8 bits (40), Expect = 1e-11 Identities = 70/80 (87%) Strand = Plus / Minus Query: 215 ctacatccgaggagagtgcatttgtcgatacgatgagccctcgggtgatctattctcggg 274 ||||||||| || ||||||||||| |||||||| ||||||||||| ||||| ||||| || Sbjct: 677 ctacatccgtggcgagtgcatttgccgatacgaagagccctcgggcgatctgttctcagg 618 Query: 275 cgacgacctgccgaggccga 294 |||||||||| || ||||| Sbjct: 617 ggacgacctgctgacgccga 598 Score = 67.9 bits (34), Expect = 4e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 233 catttgtcgatacgatgagccctcgggtgatctattctcgggcgacgacctgccgaggcc 292 |||||| |||||||| ||||||||||||| |||||| || || ||||||||||||| ||| Sbjct: 497 catttgccgatacgaagagccctcgggtggtctattttcaggggacgacctgccgacgcc 438 Query: 293 ga 294 || Sbjct: 437 ga 436 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 144 cccatcttttcttacaagcaactcaggttccaaat 178 |||||| ||||||||||||| ||| |||||||||| Sbjct: 738 cccatcgtttcttacaagcatctcgggttccaaat 704 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 357 tgctgtgagctccaccagcttgtctcacagtcgactggcatca 399 ||||||||| ||||||||||||||| ||||| || ||||||| Sbjct: 538 tgctgtgaggaccaccagcttgtctcgcagtccacaggcatca 496
>gb|AY104627.1| Zea mays PCO126290 mRNA sequence Length = 1295 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 537 ggggcaggtcgcatgcctcctgatctatgagctccagcgaaaaggctggatgatgaactc 596 ||||||||||||||||||||||| ||||| | ||||| || | ||| ||||||||| || Sbjct: 1262 ggggcaggtcgcatgcctcctgacctatggcccccagcaaataagctagatgatgaattc 1203 Query: 597 tgcgggtactgttcgttgatgctaccatgtgccctcatgaactga 641 || ||||||||||| ||||||| ||||| ||||||||||||||| Sbjct: 1202 tgttggtactgttcgctgatgctgccatgagccctcatgaactga 1158
>dbj|AK104006.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-F10, full insert sequence Length = 458 Score = 89.7 bits (45), Expect = 1e-14 Identities = 137/168 (81%), Gaps = 6/168 (3%) Strand = Plus / Minus Query: 230 gtgcatttgtcgatacgatgagccctcgggtgatctattctcgggcgacgacctgccgag 289 ||||||||| ||||||||||||||||||||||||| ||| || || || || || || | Sbjct: 163 gtgcatttgccgatacgatgagccctcgggtgatcgattttccggagatgatcttccaac 104 Query: 290 gccgatccactggccaaagagtctcctcggcgcaggtgcgggtgtggattctgatgcgcc 349 || ||||| || ||||| |||||||| || ||||| |||||| ||||||| || Sbjct: 103 accaatccattgcccaaatagtctccttggagcaggcgcgggt------tctgatgtacc 50 Query: 350 atgagactgctgtgagctccaccagcttgtctcacagtcgactggcat 397 |||||| || ||||| ||||||||| ||||||||||||| |||||||| Sbjct: 49 atgagattgttgtgaactccaccagtttgtctcacagtccactggcat 2
>emb|CR936839.12| Mouse DNA sequence from clone CH29-120A16 on chromosome 1, complete sequence Length = 250586 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 ttttttccccatcttttcttaca 159 ||||||||||||||||||||||| Sbjct: 73156 ttttttccccatcttttcttaca 73178
>emb|AL645744.16| Mouse DNA sequence from clone RP23-148E7 on chromosome 1 Contains the Icos gene for inducible T-cell co-stimulator, complete sequence Length = 108015 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 137 ttttttccccatcttttcttaca 159 ||||||||||||||||||||||| Sbjct: 81466 ttttttccccatcttttcttaca 81444
>emb|AL645951.20| Mouse DNA sequence from clone DN-29B18 on chromosome 1 Contains a ribosomal protein L17 (RPL17) pseudogene and a tigger transposable element derived 1 (TIGD1) pseudogene, complete sequence Length = 129519 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 137 ttttttccccatcttttcttaca 159 ||||||||||||||||||||||| Sbjct: 34660 ttttttccccatcttttcttaca 34638
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 284 gccgaggccgatccactggccaaag 308 |||||||||||||| |||||||||| Sbjct: 1024135 gccgaggccgatcccctggccaaag 1024159
>gb|AY377869.1| Onion grassy shoot phytoplasma isolate 3111 16S ribosomal RNA gene, partial sequence Length = 1115 Score = 42.1 bits (21), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 133 atggttttttccccatcttttctt 156 ||||||||| |||||||||||||| Sbjct: 279 atggtttttnccccatcttttctt 256
>gb|AC122298.3| Mus musculus BAC clone RP23-269A11 from 12, complete sequence Length = 151332 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 136 gttttttccccatcttttctt 156 ||||||||||||||||||||| Sbjct: 28194 gttttttccccatcttttctt 28214
>gb|AC005768.17|AC005768 Homo sapiens chromosome 4 clone C0315N08, complete sequence Length = 190544 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 136 gttttttccccatcttttctt 156 ||||||||||||||||||||| Sbjct: 157073 gttttttccccatcttttctt 157093
>ref|NM_184029.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1317 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 606 tgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||||| ||||||| | ||||||||| Sbjct: 938 tgttcgttgatgttaccatgcggcctcatgaa 907
>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete genome Length = 3397754 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 505 aaaatgttgggttttccggttgag 528 |||||| ||||||||||||||||| Sbjct: 1817454 aaaatgctgggttttccggttgag 1817431
>gb|AC150644.4| Bos taurus BAC CH240-223I2 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 199501 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 gttttttccccatcttttct 155 |||||||||||||||||||| Sbjct: 67703 gttttttccccatcttttct 67684
>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome Length = 5650368 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 408 ggcgcgaagcgatcgcgctc 427 |||||||||||||||||||| Sbjct: 3772023 ggcgcgaagcgatcgcgctc 3772004
>gb|AC103355.9| Mus musculus chromosome 14, clone RP24-482C10, complete sequence Length = 192348 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 361 gtgagctccaccagcttgtc 380 |||||||||||||||||||| Sbjct: 17019 gtgagctccaccagcttgtc 17000
>gb|AC109213.6| Mus musculus chromosome 16, clone RP23-345L20, complete sequence Length = 244558 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 502 ggcaaaatgttgggttttcc 521 |||||||||||||||||||| Sbjct: 74746 ggcaaaatgttgggttttcc 74765
>gb|AF533892.1| Mus musculus p63 (Trp63) gene, alternatively spliced, complete cds Length = 208158 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 502 ggcaaaatgttgggttttcc 521 |||||||||||||||||||| Sbjct: 202198 ggcaaaatgttgggttttcc 202217
>emb|AL161628.9| Human DNA sequence from clone RP11-31K16 on chromosome 9 Contains a pseudogene similar to part of nucleolar protein 5A (56kDa with KKE/D repeat) (NOL5A) (NOP56), the ELAVL2 gene for ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (HUB, HELN1), two novel genes, the 5' end of a novel gene and a CpG island, complete sequence Length = 183483 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 gaaaaggctggatgatgaac 594 |||||||||||||||||||| Sbjct: 79276 gaaaaggctggatgatgaac 79295
>emb|AL096774.9|HSDJ144C9 Human DNA sequence from clone RP1-144C9 on chromosome 1p34.3-36.11 Contains the gene for a novel protein, a ribosomal protein S24 (RPS24) pseudogene, the GPR3 gene for G protein-coupled receptor 3 and the 3' end of the WASF2 gene for WAS protein family, member 2, complete sequence Length = 77322 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 526 gaggtggcggaggggcaggt 545 |||||||||||||||||||| Sbjct: 33814 gaggtggcggaggggcaggt 33833
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 512 tgggttttccggttgaggtg 531 |||||||||||||||||||| Sbjct: 2769991 tgggttttccggttgaggtg 2770010
>emb|AL645606.22| Mouse DNA sequence from clone RP23-374K2 on chromosome 1, complete sequence Length = 193458 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 197 ttgcctctgcagagggggct 216 |||||||||||||||||||| Sbjct: 81437 ttgcctctgcagagggggct 81418
>ref|NM_006990.2| Homo sapiens WAS protein family, member 2 (WASF2), mRNA Length = 4270 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 526 gaggtggcggaggggcaggt 545 |||||||||||||||||||| Sbjct: 1192 gaggtggcggaggggcaggt 1173
>dbj|AK075231.1| Homo sapiens cDNA FLJ90750 fis, clone PLACE2000118, weakly similar to WISKOTT-ALDRICH SYNDROME PROTEIN HOMOLOG Length = 3417 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 526 gaggtggcggaggggcaggt 545 |||||||||||||||||||| Sbjct: 342 gaggtggcggaggggcaggt 323
>gb|AC097625.11| Homo sapiens X BAC RP11-478H11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 194492 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ttttttccccatcttttctt 156 |||||||||||||||||||| Sbjct: 83595 ttttttccccatcttttctt 83614
>gb|AC026708.6| Homo sapiens chromosome 5 clone CTD-2078B5, complete sequence Length = 142047 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 525 tgaggtggcggaggggcagg 544 |||||||||||||||||||| Sbjct: 73056 tgaggtggcggaggggcagg 73075
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 606 tgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||||| ||||||| | ||||||||| Sbjct: 14001649 tgttcgttgatgttaccatgcggcctcatgaa 14001618
>dbj|AP003764.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1051E10 Length = 207782 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 606 tgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||||| ||||||| | ||||||||| Sbjct: 161951 tgttcgttgatgttaccatgcggcctcatgaa 161920
>dbj|AP003258.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0463A02 Length = 151041 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 606 tgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||||| ||||||| | ||||||||| Sbjct: 77394 tgttcgttgatgttaccatgcggcctcatgaa 77363
>gb|BC012329.1| Homo sapiens WAS protein family, member 2, mRNA (cDNA clone IMAGE:4555042) Length = 1504 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 526 gaggtggcggaggggcaggt 545 |||||||||||||||||||| Sbjct: 1192 gaggtggcggaggggcaggt 1173
>emb|BX548065.6| Mouse DNA sequence from clone RP23-163B21 on chromosome X, complete sequence Length = 225082 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 190 acttaggttgcctctgcaga 209 |||||||||||||||||||| Sbjct: 53481 acttaggttgcctctgcaga 53500
>dbj|AK070217.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023044E12, full insert sequence Length = 2298 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 606 tgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||||| ||||||| | ||||||||| Sbjct: 1632 tgttcgttgatgttaccatgcggcctcatgaa 1601
>dbj|AK058986.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-020-E07, full insert sequence Length = 1315 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 606 tgttcgttgatgctaccatgtgccctcatgaa 637 |||||||||||| ||||||| | ||||||||| Sbjct: 649 tgttcgttgatgttaccatgcggcctcatgaa 618
>gb|AC003669.1|AC003669 Homo sapiens Xp22 BAC GS-594A7 (Genome Systems Human BAC library) contains Bmx gene, complete sequence Length = 159446 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ttttttccccatcttttctt 156 |||||||||||||||||||| Sbjct: 2160 ttttttccccatcttttctt 2179
>gb|BC040943.1| Homo sapiens WAS protein family, member 2, mRNA (cDNA clone MGC:48747 IMAGE:4385298), complete cds Length = 2129 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 526 gaggtggcggaggggcaggt 545 |||||||||||||||||||| Sbjct: 1183 gaggtggcggaggggcaggt 1164
>gb|AC166113.3| Mus musculus BAC clone RP23-23E6 from chromosome 14, complete sequence Length = 252394 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 361 gtgagctccaccagcttgtc 380 |||||||||||||||||||| Sbjct: 163882 gtgagctccaccagcttgtc 163863
>dbj|AP006422.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT33E11, TM0310b, complete sequence Length = 93261 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 52 ttccctccaggttatttcat 71 |||||||||||||||||||| Sbjct: 37123 ttccctccaggttatttcat 37142
>gb|AC112493.2| Homo sapiens X BAC RP11-2M5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 164480 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 145 ccatcttttcttacaagcaa 164 |||||||||||||||||||| Sbjct: 58982 ccatcttttcttacaagcaa 58963
>dbj|AB026542.1| Homo sapiens WAVE2 mRNA for WASP-family protein, complete cds Length = 1497 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 526 gaggtggcggaggggcaggt 545 |||||||||||||||||||| Sbjct: 976 gaggtggcggaggggcaggt 957 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,804,936 Number of Sequences: 3902068 Number of extensions: 4804936 Number of successful extensions: 109690 Number of sequences better than 10.0: 44 Number of HSP's better than 10.0 without gapping: 44 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 109415 Number of HSP's gapped (non-prelim): 272 length of query: 641 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 618 effective length of database: 17,143,297,704 effective search space: 10594557981072 effective search space used: 10594557981072 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
