>gb|AC009869.7| Homo sapiens chromosome 11, clone RP11-222N13, complete sequence
          Length = 192696

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 43    gggctgggcacaacacatctct 64
             ||||||||||||||||||||||
Sbjct: 26236 gggctgggcacaacacatctct 26257

>gb|AC013562.6| Homo sapiens chromosome 8, clone RP11-313C15, complete sequence
          Length = 188755

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 89    acaacagaagggaaggaata 108
             ||||||||||||||||||||
Sbjct: 83713 acaacagaagggaaggaata 83694

>gb|AC026970.7| Homo sapiens chromosome 11, clone RP11-472K20, complete sequence
          Length = 132987

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    ctagcactgggctgggcaca 54
             ||||||||||||||||||||
Sbjct: 85233 ctagcactgggctgggcaca 85214

>gb|AC022858.8| Homo sapiens chromosome 8, clone RP11-326E22, complete sequence
          Length = 187340

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    ctagcactgggctgggcaca 54
             ||||||||||||||||||||
Sbjct: 44117 ctagcactgggctgggcaca 44098

>emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on chromosome X, complete
              sequence
          Length = 194258

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 115    acctaataatccagccatca 134
              ||||||||||||||||||||
Sbjct: 175133 acctaataatccagccatca 175152

>gb|AC090692.9| Homo sapiens chromosome 11, clone RP11-698N11, complete sequence
          Length = 179494

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    ctagcactgggctgggcaca 54
             ||||||||||||||||||||
Sbjct: 16616 ctagcactgggctgggcaca 16597

>gb|AC145589.3| Mus musculus BAC clone RP24-174M10 from chromosome Y, complete sequence
          Length = 152506

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 77     gatcatgaccctacaacag 95
              |||||||||||||||||||
Sbjct: 107177 gatcatgaccctacaacag 107159

>emb|AL450342.16| Human DNA sequence from clone RP11-481A12 on chromosome 10 Contains a
             pseudogene similar to part of ral guanine nucleotide
             dissociation stimulator (RALGDS), the MSMB gene for
             microseminoprotein beta, the NCOA4 gene for nuclear
             receptor coactivator 4, the TIMM23 gene for translocase of
             inner mitochondrial membrane 23, a  poly (ADP-ribose)
             glycohydrolase (PARG) pseudogene, a ribosomal protein L35a
             (RPL35A) pseudogene and three CpG islands, complete
             sequence
          Length = 190015

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 34    tctagcactgggctgggca 52
             |||||||||||||||||||
Sbjct: 28383 tctagcactgggctgggca 28401

>emb|AL353588.25| Human DNA sequence from clone RP11-444E17 on chromosome 6 Contains the
             gene for a novel protein (possible ortholog of mouse
             TCTE1), the gene for novel protein (KIAA1270), a novel
             gene, the 5' end of a novel gene (possible ortholog of
             rodent CDC5-like protein), the 3' part of a novel gene and
             three CpG islands, complete sequence
          Length = 145947

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   aatacagtacacctaataa 123
             |||||||||||||||||||
Sbjct: 98032 aatacagtacacctaataa 98014

>emb|AL121921.7|HSJ560I16 Human DNA sequence from clone RP4-560I16 on chromosome 20 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 59209

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 61    ctctggagcaagggttgat 79
             |||||||||||||||||||
Sbjct: 32511 ctctggagcaagggttgat 32493

>gb|U89944.1|TOU89944 Taenia ovis host-protective antigen (To16.17) mRNA, partial cds
          Length = 587

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 137 cgatgcatcctctgctccg 155
           |||||||||||||||||||
Sbjct: 443 cgatgcatcctctgctccg 425

>gb|AY147844.1| Taenia ovis oncosphere protein TO16 gene, complete cds
          Length = 3738

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 137  cgatgcatcctctgctccg 155
            |||||||||||||||||||
Sbjct: 3595 cgatgcatcctctgctccg 3577

>emb|AL833781.5| Mouse DNA sequence from clone RP23-447J12 on chromosome 4, complete
             sequence
          Length = 165700

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 88    tacaacagaagggaaggaa 106
             |||||||||||||||||||
Sbjct: 53806 tacaacagaagggaaggaa 53824


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,303,691
Number of Sequences: 3902068
Number of extensions: 1303691
Number of successful extensions: 82139
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82112
Number of HSP's gapped (non-prelim): 27
length of query: 159
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 137
effective length of database: 17,147,199,772
effective search space: 2349166368764
effective search space used: 2349166368764
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)